Gene Page: SHANK1

Summary
GeneID  50944
Symbol  SHANK1
Synonyms  SPANK-1|SSTRIP|synamon
Description  SH3 and multiple ankyrin repeat domains 1
See related  HGNC:15474|MIM:604999|Ensembl:ENSG00000161681|HPRD:05413|
Locus tag  -
Gene type  protein-coding
Map location  19q13.3
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 2 
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.0923 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIPI10551867 |11583995 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007016cytoskeletal anchoring at plasma membraneNAS10551867 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0030425dendriteNASneuron, axon, dendrite (GO term level: 6)10551867 
GO:0045211postsynaptic membraneIEASynap, Neurotransmitter (GO term level: 5)-
GO:0045202synapseIEAneuron, Synap, Neurotransmitter, Glial (GO term level: 2)-
GO:0005622intracellularNAS10551867 
GO:0005624membrane fractionIDA10551867 
GO:0005737cytoplasmIEA-
GO:0005886plasma membraneIEA-
GO:0030054cell junctionIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ARHGEF7BETA-PIX | COOL1 | DKFZp686C12170 | DKFZp761K1021 | KIAA0142 | KIAA0412 | Nbla10314 | P50 | P50BP | P85 | P85COOL1 | P85SPR | PAK3 | PIXBRho guanine nucleotide exchange factor (GEF) 7-HPRD,BioGRID12626503 
BAI2-brain-specific angiogenesis inhibitor 2-HPRD,BioGRID10964907 
BAIAP2BAP2 | IRSP53BAI1-associated protein 2-HPRD,BioGRID12504591 
DLG4FLJ97752 | FLJ98574 | PSD95 | SAP90discs, large homolog 4 (Drosophila)-HPRD,BioGRID10433268 
DLGAP1DAP-1 | DAP-1-ALPHA | DAP-1-BETA | GKAP | MGC88156 | SAPAP1 | hGKAPdiscs, large (Drosophila) homolog-associated protein 1Co-crystal StructureBioGRID12954649 
DNM2CMTDI1 | CMTDIB | DI-CMTB | DYN2 | DYNIIdynamin 2-HPRD,BioGRID11583995 
LPHN1CIRL1 | CL1 | LEC2latrophilin 1CIRL1 interacts with SSTRIP. This interaction was modeled on a demonstrated interaction between CIRL1 from an unspecified species and human SSTRIP .BIND10964907 
Two-hybridBioGRID10964907 
LPHN2CIRL2 | CL2 | LEC1 | LPHH1latrophilin 2Two-hybridBioGRID10964907 
SHANK1SPANK-1 | SSTRIP | synamonSH3 and multiple ankyrin repeat domains 1-HPRD,BioGRID12954649 
SHARPINDKFZp434N1923 | SIPL1SHANK-associated RH domain interactor-HPRD,BioGRID11178875 |12753155 
SPTAN1(ALPHA)II-SPECTRIN | FLJ44613 | NEASspectrin, alpha, non-erythrocytic 1 (alpha-fodrin)-HPRD,BioGRID11509555 
SSTR2-somatostatin receptor 2-HPRD,BioGRID10551867 
TANC1KIAA1728 | ROLSB | TANCtetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1-HPRD15673434 
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-18424301Ahsa-miR-184UGGACGGAGAACUGAUAAGGGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.