Gene Page: ISOC1

Summary
GeneID  51015
Symbol  ISOC1
Synonyms  CGI-111
Description  isochorismatase domain containing 1
See related  HGNC:24254|Ensembl:ENSG00000066583|
Locus tag  -
Gene type  protein-coding
Map location  5q22.1-q33.3
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.0032 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003824catalytic activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0008152metabolic processIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005777peroxisomeISS14561759 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-15/16/195/424/497201207m8hsa-miR-15abrainUAGCAGCACAUAAUGGUUUGUG
hsa-miR-16brainUAGCAGCACGUAAAUAUUGGCG
hsa-miR-15bbrainUAGCAGCACAUCAUGGUUUACA
hsa-miR-195SZUAGCAGCACAGAAAUAUUGGC
hsa-miR-424CAGCAGCAAUUCAUGUUUUGAA
hsa-miR-497CAGCAGCACACUGUGGUUUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.