Gene Page: ZNF219

Summary
GeneID  51222
Symbol  ZNF219
Synonyms  ZFP219
Description  zinc finger protein 219
See related  HGNC:13011|MIM:605036|Ensembl:ENSG00000165804|HPRD:05435|
Locus tag  -
Gene type  protein-coding
Map location  14q11
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.047 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003700transcription factor activityTAS10819330 
GO:0008270zinc ion bindingIEA-
GO:0046872metal ion bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006355regulation of transcription, DNA-dependentIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005622intracellularIEA-
GO:0005634nucleusTAS10819330 
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
SUFUPRO1280 | SUFUH | SUFUXLsuppressor of fused homolog (Drosophila)-HPRD14611647 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-124.1194200m8hsa-miR-124aUUAAGGCACGCGGUGAAUGCCA
miR-124/5061932001A,m8hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
miR-1341861921Ahsa-miR-134brainUGUGACUGGUUGACCAGAGGG
miR-4214494551Ahsa-miR-421GGCCUCAUUAAAUGUUUGUUG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.