Gene Page: SLC22A17

Summary
GeneID  51310
Symbol  SLC22A17
Synonyms  BOCT|BOIT|NGALR|hBOIT
Description  solute carrier family 22, member 17
See related  HGNC:23095|MIM:611461|Ensembl:ENSG00000092096|HPRD:15349|
Locus tag  -
Gene type  protein-coding
Map location  14q11.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.047 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005215transporter activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006811ion transportIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIDA18029348 
GO:0005737cytoplasmIDA18029348 
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-
GO:0031965nuclear membraneIDA18029348 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-4942983041Ahsa-miR-494brainUGAAACAUACACGGGAAACCUCUU
miR-92532591Ahsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.