|
GeneID |
51310
|
Symbol |
SLC22A17
|
Synonyms |
BOCT|BOIT|NGALR|hBOIT
|
Description |
solute carrier family 22, member 17 |
See related |
HGNC:23095|MIM:611461|Ensembl:ENSG00000092096|HPRD:15349| |
Locus tag |
- |
Gene type |
protein-coding |
Map location |
14q11.2 |
|
|
|
Gene set name |
Method of gene set |
Evidence |
Info |
GSMA_I | genome scan meta-analysis | Psr: 0.047 | |
|
|
General Gene Expression (microarray) ? |
|
|
|
Gene Expression in Brain Regions (new) |
|
|
Top co-expressed genes in Brain Regions (new) |
|
Gene | Pearson's Correlation | Spearman's Correlation | | |
Top 10 positively co-expressed genes |
Top 10 negatively co-expressed genes | |
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|
GO:0005215 | transporter activity | IEA | | - |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
---|
GO:0006811 | ion transport | IEA | | - |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
---|
GO:0005634 | nucleus | IDA | | 18029348 |
GO:0005737 | cytoplasm | IDA | | 18029348 |
GO:0016020 | membrane | IEA | | - |
GO:0016021 | integral to membrane | IEA | | - |
GO:0031965 | nuclear membrane | IDA | | 18029348 |
|
|
miR-494 | 298 | 304 | 1A | hsa-miR-494brain | UGAAACAUACACGGGAAACCUCUU | miR-9 | 253 | 259 | 1A | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
|
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.
|