Gene Page: LGSN

Summary
GeneID  51557
Symbol  LGSN
Synonyms  GLULD1|LGS|MGC163238|MGC163240
Description  lengsin, lens protein with glutamine synthetase domain
See related  HGNC:21016|MIM:611470|Ensembl:ENSG00000146166|HPRD:13585|
Locus tag  -
Gene type  protein-coding
Map location  6pter-q22.33
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004356glutamate-ammonia ligase activityIEAglutamate (GO term level: 7)-
GO:0003824catalytic activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006807nitrogen compound metabolic processIEA-
GO:0006542glutamine biosynthetic processIEA-
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1532222281Ahsa-miR-153UUGCAUAGUCACAAAAGUGA
miR-4482212281A,m8hsa-miR-448UUGCAUAUGUAGGAUGUCCCAU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.