Gene Page: C7orf28A

Summary
GeneID  51622
Symbol  C7orf28A
Synonyms  CGI-43|H_DJ1163J12.2
Description  chromosome 7 open reading frame 28A
See related  HGNC:21691|Ensembl:ENSG00000122674|HPRD:12915|
Locus tag  -
Gene type  protein-coding
Map location  7p22.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
ExpressionExpressionP value: 1.947 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1371031101A,m8hsa-miR-137UAUUGCUUAAGAAUACGCGUAG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.