Gene Page: PLGLB2

Summary
GeneID  5342
Symbol  PLGLB2
Synonyms  PLGP1
Description  plasminogen-like B2
See related  HGNC:9073|Ensembl:ENSG00000125551|HPRD:01416|
Locus tag  -
Gene type  protein-coding
Map location  2p11-q11
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.0004 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-29198019871A,m8hsa-miR-29aSZUAGCACCAUCUGAAAUCGGUU
hsa-miR-29bSZUAGCACCAUUUGAAAUCAGUGUU
hsa-miR-29cSZUAGCACCAUUUGAAAUCGGU
miR-543251825241Ahsa-miR-543AAACAUUCGCGGUGCACUUCU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.