Gene Page: NLGN3

Summary
GeneID  54413
Symbol  NLGN3
Synonyms  ASPGX1|AUTSX1|HNL3|KIAA1480
Description  neuroligin 3
See related  HGNC:14289|MIM:300336|Ensembl:ENSG00000196338|HPRD:02275|
Locus tag  -
Gene type  protein-coding
Map location  Xq13.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIPI17292328 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0050808synapse organizationIMPneuron, Synap (GO term level: 5)15150161 
GO:0007155cell adhesionIEA-
GO:0035176social behaviorIMP12669065 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0045202synapseISSneuron, Synap, Neurotransmitter, Glial (GO term level: 2)-
GO:0005737cytoplasmIDA18029348 
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-
GO:0009986cell surfaceIDA15150161 |17292328 
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
DLG2DKFZp781D1854 | DKFZp781E0954 | FLJ37266 | MGC131811 | PSD-93discs, large homolog 2, chapsyn-110 (Drosophila)-HPRD,BioGRID9278515 
DLG3KIAA1232 | MRX | MRX90 | NE-Dlg | NEDLG | SAP102discs, large homolog 3 (neuroendocrine-dlg, Drosophila)-HPRD,BioGRID9278515 
DLG4FLJ97752 | FLJ98574 | PSD95 | SAP90discs, large homolog 4 (Drosophila)-HPRD,BioGRID9278515 
NRXN1DKFZp313P2036 | FLJ35941 | Hs.22998 | KIAA0578neurexin 1-HPRD8576240 |9325340 
-HPRD,BioGRID8576240 
NRXN2FLJ40892 | KIAA0921neurexin 2-HPRD8576240 
NRXN3KIAA0743 | MGC176711neurexin 3-HPRD,BioGRID8576240 
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1869169221Ahsa-miR-186CAAAGAAUUCUCCUUUUGGGCUU
miR-29350356m8hsa-miR-29aSZUAGCACCAUCUGAAAUCGGUU
hsa-miR-29bSZUAGCACCAUUUGAAAUCAGUGUU
hsa-miR-29cSZUAGCACCAUUUGAAAUCGGU
miR-3204074131Ahsa-miR-320AAAAGCUGGGUUGAGAGGGCGAA
miR-493-5p1821891A,m8hsa-miR-493-5pUUGUACAUGGUAGGCUUUCAUU
miR-539941947m8hsa-miR-539GGAGAAAUUAUCCUUGGUGUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.