Gene Page: DGCR8

Summary
GeneID  54487
Symbol  DGCR8
Synonyms  C22orf12|DGCRK6|Gy1
Description  DiGeorge syndrome critical region gene 8
See related  HGNC:2847|MIM:609030|Ensembl:ENSG00000128191|HPRD:09913|
Locus tag  -
Gene type  protein-coding
Map location  22q11.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.031 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003725double-stranded RNA bindingIEA-
GO:0005515protein bindingIPI15574589 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0031053primary microRNA processingIDA15531877 |15574589 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005622intracellularIEA-
GO:0005634nucleusIDA15574589 
GO:0005737cytoplasmIDA11256614 
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
RNASENDROSHA | ETOHI2 | HSA242976 | RANSE3L | RN3 | RNASE3Lribonuclease type III, nuclearDrosha interacts with DGCR8 to form the Microprocessor complex.BIND15531877 
hDrosha interacts with DGCR8.BIND15589161 
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-205314320m8hsa-miR-205UCCUUCAUUCCACCGGAGUCUG
miR-2087207261Ahsa-miR-208AUAAGACGAGCAAAAAGCUUGU
miR-4997197261A,m8hsa-miR-499UUAAGACUUGCAGUGAUGUUUAA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.