Gene Page: HMGCLL1

Summary
GeneID  54511
Symbol  HMGCLL1
Synonyms  DKFZp434G1411|bA418P12.1
Description  3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase-like 1
See related  HGNC:21359|Ensembl:ENSG00000146151|HPRD:13663|
Locus tag  RP11-418P12.1
Gene type  protein-coding
Map location  6p12.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_IIEgenome scan meta-analysis (European-ancestry samples)Psr: 0.04433 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004419hydroxymethylglutaryl-CoA lyase activityIEA-
GO:0016829lyase activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0008152metabolic processIEA-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1334754811Ahsa-miR-133aUUGGUCCCCUUCAACCAGCUGU
hsa-miR-133bUUGGUCCCCUUCAACCAGCUA
miR-1375155211Ahsa-miR-137UAUUGCUUAAGAAUACGCGUAG
miR-142-5p570576m8hsa-miR-142-5pCAUAAAGUAGAAAGCACUAC
miR-182454460m8hsa-miR-182UUUGGCAAUGGUAGAACUCACA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.