Gene Page: TRPM7

Summary
GeneID  54822
Symbol  TRPM7
Synonyms  CHAK|CHAK1|FLJ20117|FLJ25718|LTRPC7|TRP-PLIK
Description  transient receptor potential cation channel, subfamily M, member 7
See related  HGNC:17994|MIM:605692|Ensembl:ENSG00000092439|HPRD:10418|
Locus tag  -
Gene type  protein-coding
Map location  15q21
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
ExpressionExpressionP value: 2.551 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0003779actin bindingIEA-
GO:0005509calcium ion bindingIEA-
GO:0005524ATP bindingIEA-
GO:0005262calcium channel activityIEA-
GO:0004674protein serine/threonine kinase activityIEA-
GO:0005216ion channel activityIEA-
GO:0016740transferase activityIEA-
GO:0008270zinc ion bindingIEA-
GO:0017022myosin bindingIEA-
GO:0016301kinase activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006816calcium ion transportIEA-
GO:0006811ion transportIEA-
GO:0016340calcium-dependent cell-matrix adhesionIEA-
GO:0031032actomyosin structure organizationIEA-
GO:0046777protein amino acid autophosphorylationIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0001726ruffleIEA-
GO:0016021integral to membraneIEA-
GO:0005886plasma membraneIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
EEF2EEF-2 | EF2eukaryotic translation elongation factor 2-HPRD14594813 
HIST3H3H3.4 | H3/g | H3FT | H3t | MGC126886 | MGC126888histone cluster 3, H3-HPRD,BioGRID14594813 
MBPMGC99675myelin basic protein-HPRD,BioGRID14594813 
PLCB1FLJ45792 | PI-PLC | PLC-154 | PLC-I | PLC154phospholipase C, beta 1 (phosphoinositide-specific)-HPRD,BioGRID11941371 
PLCB2FLJ38135phospholipase C, beta 2-HPRD,BioGRID11941371 
PLCB3FLJ37084phospholipase C, beta 3 (phosphatidylinositol-specific)Reconstituted ComplexBioGRID11941371 
PLCG1PLC-II | PLC1 | PLC148 | PLCgamma1phospholipase C, gamma 1-HPRD,BioGRID11941371 
TRPM6CHAK2 | HMGX | HOMG | HOMG1 | HSHtransient receptor potential cation channel, subfamily M, member 6-HPRD14976260 
TRPM7CHAK | CHAK1 | FLJ20117 | FLJ25718 | LTRPC7 | TRP-PLIKtransient receptor potential cation channel, subfamily M, member 7-HPRD,BioGRID14594813 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-135721727m8hsa-miR-135aUAUGGCUUUUUAUUCCUAUGUGA
hsa-miR-135bUAUGGCUUUUCAUUCCUAUGUG
miR-2112521258m8hsa-miR-21brainUAGCUUAUCAGACUGAUGUUGA
hsa-miR-590GAGCUUAUUCAUAAAAGUGCAG
miR-30-5p137613831A,m8hsa-miR-30a-5pUGUAAACAUCCUCGACUGGAAG
hsa-miR-30cbrainUGUAAACAUCCUACACUCUCAGC
hsa-miR-30dSZUGUAAACAUCCCCGACUGGAAG
hsa-miR-30bSZUGUAAACAUCCUACACUCAGCU
hsa-miR-30e-5pUGUAAACAUCCUUGACUGGA
miR-381133413401Ahsa-miR-381UAUACAAGGGCAAGCUCUCUGU
miR-9331337m8hsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA
hsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.