|
GeneID |
54918
|
Symbol |
CMTM6
|
Synonyms |
CKLFSF6|FLJ20396|PRO2219
|
Description |
CKLF-like MARVEL transmembrane domain containing 6 |
See related |
HGNC:19177|MIM:607889|Ensembl:ENSG00000091317|HPRD:06987| |
Locus tag |
- |
Gene type |
protein-coding |
Map location |
3p22.3 |
|
|
|
Gene set name |
Method of gene set |
Evidence |
Info |
GSMA_I | genome scan meta-analysis | Psr: 0.006 | |
|
|
General Gene Expression (microarray) ? |
|
|
|
Gene Expression in Brain Regions (new) |
|
|
Top co-expressed genes in Brain Regions (new) |
|
Gene | Pearson's Correlation | Spearman's Correlation | | |
Top 10 positively co-expressed genes |
PSMB7 | 0.90 | 0.90 | | |
EIF6 | 0.89 | 0.89 | | |
PSMA7 | 0.88 | 0.89 | | |
ILKAP | 0.88 | 0.90 | | |
TRIM39 | 0.88 | 0.87 | | |
EIF2B3 | 0.87 | 0.89 | | |
RPAIN | 0.87 | 0.90 | | |
EIF2B4 | 0.87 | 0.87 | | |
WIBG | 0.87 | 0.88 | | |
BCS1L | 0.87 | 0.88 | | |
Top 10 negatively co-expressed genes | AF347015.27 | -0.73 | -0.79 | | |
AF347015.8 | -0.72 | -0.78 | | |
AF347015.15 | -0.71 | -0.79 | | |
MT-CYB | -0.71 | -0.78 | | |
AF347015.33 | -0.71 | -0.77 | | |
AF347015.26 | -0.70 | -0.81 | | |
MT-CO2 | -0.70 | -0.74 | | |
AF347015.2 | -0.68 | -0.77 | | |
AF347015.31 | -0.68 | -0.74 | | |
MT-ATP8 | -0.67 | -0.80 | | |
|
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|
GO:0005125 | cytokine activity | IEA | | - |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
---|
GO:0006935 | chemotaxis | IEA | | - |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
---|
GO:0005615 | extracellular space | IEA | | - |
GO:0016020 | membrane | IEA | | - |
GO:0016021 | integral to membrane | IEA | | - |
|
|
miR-9 | 773 | 780 | 1A,m8 | hsa-miR-9SZ | UCUUUGGUUAUCUAGCUGUAUGA |
|
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.
|