Gene Page: FEZF2

Summary
GeneID  55079
Symbol  FEZF2
Synonyms  FEZ|FEZL|FKSG36|FLJ10142|TOF|ZFP312|ZNF312
Description  FEZ family zinc finger 2
See related  HGNC:13506|MIM:607414|Ensembl:ENSG00000153266|HPRD:07596|
Locus tag  -
Gene type  protein-coding
Map location  3p14.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 5 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003677DNA bindingIEA-
GO:0008270zinc ion bindingIEA-
GO:0046872metal ion bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007413axonal fasciculationIEAneuron, axon (GO term level: 13)-
GO:0007411axon guidanceIEAaxon (GO term level: 13)-
GO:0030900forebrain developmentIEABrain (GO term level: 8)-
GO:0016358dendrite developmentIEAneurite, dendrite (GO term level: 11)-
GO:0007399nervous system developmentIEAneurite (GO term level: 5)-
GO:0006355regulation of transcription, DNA-dependentIEA-
GO:0006350transcriptionIEA-
GO:0007626locomotory behaviorIEA-
GO:0007275multicellular organismal developmentIEA-
GO:0030154cell differentiationIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005622intracellularIEA-
GO:0005634nucleusIEA-
 
Pathway annotation
Pathway namePathway size# SZGR genes in pathwayInfo
LEE_NEURAL_CREST_STEM_CELL_DN 11879All SZGR genes in this pathway
KAN_RESPONSE_TO_ARSENIC_TRIOXIDE 12380All SZGR genes in this pathway
BENPORATH_SUZ12_TARGETS 1038678All SZGR genes in this pathway
BENPORATH_EED_TARGETS 1062725All SZGR genes in this pathway
BENPORATH_ES_WITH_H3K27ME3 1118744All SZGR genes in this pathway
BENPORATH_PRC2_TARGETS 652441All SZGR genes in this pathway
KONDO_PROSTATE_CANCER_HCP_WITH_H3K27ME3 9772All SZGR genes in this pathway
MEISSNER_NPC_HCP_WITH_H3K27ME3 7959All SZGR genes in this pathway
MEISSNER_BRAIN_HCP_WITH_H3K4ME3_AND_H3K27ME3 1069729All SZGR genes in this pathway
MIKKELSEN_MCV6_HCP_WITH_H3K27ME3 435318All SZGR genes in this pathway
MIKKELSEN_NPC_HCP_WITH_H3K27ME3 341243All SZGR genes in this pathway
MIKKELSEN_MEF_HCP_WITH_H3K27ME3 590403All SZGR genes in this pathway
MARTENS_TRETINOIN_RESPONSE_UP 857456All SZGR genes in this pathway
VERHAAK_GLIOBLASTOMA_NEURAL 12985All SZGR genes in this pathway
ZWANG_TRANSIENTLY_UP_BY_2ND_EGF_PULSE_ONLY 1725838All SZGR genes in this pathway
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1381251311Ahsa-miR-138brainAGCUGGUGUUGUGAAUC
miR-493-5p3553611Ahsa-miR-493-5pUUGUACAUGGUAGGCUUUCAUU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.