Gene Page: C12orf35

Summary
GeneID  55196
Symbol  C12orf35
Synonyms  FLJ10652|FLJ20696
Description  chromosome 12 open reading frame 35
See related  HGNC:25559|Ensembl:ENSG00000174718|HPRD:07691|
Locus tag  -
Gene type  protein-coding
Map location  12p11.21
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
ExpressionExpressionP value: 1.434 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
TBC1D4AS160 | DKFZp779C0666TBC1 domain family, member 4-HPRD12421765 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-265385451A,m8hsa-miR-26abrainUUCAAGUAAUCCAGGAUAGGC
hsa-miR-26bSZUUCAAGUAAUUCAGGAUAGGUU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.