Gene Page: SPTLC3

Summary
GeneID  55304
Symbol  SPTLC3
Synonyms  C20orf38|FLJ11112|FLJ90790|SPTLC2L|dJ718P11|dJ718P11.1
Description  serine palmitoyltransferase, long chain base subunit 3
See related  HGNC:16253|MIM:611120|Ensembl:ENSG00000172296|HPRD:12765|
Locus tag  RP5-1077I2.1
Gene type  protein-coding
Map location  20p12.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.046 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004758serine C-palmitoyltransferase activityIEA-
GO:0016769transferase activity, transferring nitrogenous groupsIEA-
GO:0008415acyltransferase activityIEA-
GO:0030170pyridoxal phosphate bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0009058biosynthetic processIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005789endoplasmic reticulum membraneIEA-
GO:0005783endoplasmic reticulumIEA-
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1/206129913061A,m8hsa-miR-1UGGAAUGUAAAGAAGUAUGUA
hsa-miR-206SZUGGAAUGUAAGGAAGUGUGUGG
hsa-miR-613AGGAAUGUUCCUUCUUUGCC
miR-122130513111Ahsa-miR-122aUGGAGUGUGACAAUGGUGUUUGU
miR-409-3p12981304m8hsa-miR-409-3pCGAAUGUUGCUCGGUGAACCCCU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.