Gene Page: MED29

Summary
GeneID  55588
Symbol  MED29
Synonyms  DKFZp434H247|IXL
Description  mediator complex subunit 29
See related  HGNC:23074|Ensembl:ENSG00000063322|HPRD:13748|
Locus tag  -
Gene type  protein-coding
Map location  19q13.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.1318 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
S100A130.780.79
PSMB100.760.65
GUK10.750.67
CXCL140.750.81
SELM0.740.73
MYL30.740.78
NDUFB10.740.42
AC044839.20.730.74
TMEM1410.720.70
SEPW10.720.71
Top 10 negatively co-expressed genes
SART3-0.63-0.77
SLC39A7-0.63-0.78
SUPT6H-0.63-0.71
SMG6-0.63-0.76
SUPT5H-0.63-0.77
C17orf85-0.63-0.78
MCM3AP-0.63-0.74
CIDEB-0.63-0.75
GPATCH1-0.63-0.78
GTPBP1-0.63-0.80
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIPI14576168 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006355regulation of transcription, DNA-dependentIEA-
GO:0006350transcriptionIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
CBX4NBP16 | PC2 | hPC2chromobox homolog 4 (Pc class homolog, Drosophila)-HPRD14576168 
CCNCCycCcyclin CAffinity Capture-MSBioGRID15175163 
-HPRD14576168 
CDC2L6CDK11 | KIAA1028 | bA346C16.3cell division cycle 2-like 6 (CDK8-like)Affinity Capture-MSBioGRID15175163 
CDK8K35 | MGC126074 | MGC126075cyclin-dependent kinase 8Affinity Capture-MSBioGRID15175163 
-HPRD14576168 
MED1CRSP1 | CRSP200 | DRIP205 | DRIP230 | MGC71488 | PBP | PPARBP | PPARGBP | RB18A | TRAP220 | TRIP2mediator complex subunit 1-HPRD14576168 
Affinity Capture-MS
Affinity Capture-Western		BioGRID14638676 |15175163 
MED10L6 | MGC5309 | NUT2 | TRG20mediator complex subunit 10Affinity Capture-MS
Affinity Capture-Western		BioGRID14576168 |14638676 
|15175163 
MED11HSPC296 | MGC88387mediator complex subunit 11-HPRD,BioGRID14576168 
MED12CAGH45 | HOPA | KIAA0192 | OPA1 | TNRC11 | TRAP230mediator complex subunit 12-HPRD14576168 
Affinity Capture-MSBioGRID15175163 
MED13ARC250 | DRIP250 | HSPC221 | KIAA0593 | THRAP1 | TRAP240mediator complex subunit 13Affinity Capture-MSBioGRID15175163 
-HPRD14576168 
MED13LDKFZp781D0112 | FLJ21627 | KIAA1025 | PROSIT240 | THRAP2 | TRAP240Lmediator complex subunit 13-likeAffinity Capture-MSBioGRID15175163 
MED14CRSP150 | CRSP2 | CSRP | CXorf4 | DRIP150 | EXLM1 | MGC104513 | RGR1 | TRAP170mediator complex subunit 14-HPRD14576168 
Affinity Capture-MSBioGRID15175163 
MED15ARC105 | CAG7A | CTG7A | DKFZp686A2214 | DKFZp762B1216 | FLJ42282 | FLJ42935 | PCQAP | TIG-1 | TIG1 | TNRC7mediator complex subunit 15Affinity Capture-MSBioGRID15175163 
MED16DRIP92 | THRAP5 | TRAP95mediator complex subunit 16Affinity Capture-MSBioGRID15175163 
-HPRD14576168 
MED17CRSP6 | CRSP77 | DRIP80 | FLJ10812 | TRAP80mediator complex subunit 17-HPRD,BioGRID14576168 
MED18FLJ20045 | p28bmediator complex subunit 18-HPRD,BioGRID14576168 
MED19DT2P1G7 | LCMR1mediator complex subunit 19-HPRD,BioGRID14576168 
MED20DKFZp586D2223 | MGC29869 | PRO0213 | TRFPmediator complex subunit 20TRFP interacts with hIntersex. TRFP and hIntersex were isolated as components of the Mediator complex.BIND14576168 
Affinity Capture-MS
Affinity Capture-Western		BioGRID14576168 |15175163 
MED21SRB7 | SURB7mediator complex subunit 21Affinity Capture-MSBioGRID15175163 
-HPRD14576168 
MED22MED24 | MGC48682 | SURF5mediator complex subunit 22-HPRD14576168 
Affinity Capture-MSBioGRID15175163 
MED23CRSP130 | CRSP133 | CRSP3 | DKFZp434H0117 | DRIP130 | SUR2mediator complex subunit 23-HPRD14576168 
Affinity Capture-MSBioGRID15175163 
MED24ARC100 | CRSP100 | CRSP4 | DRIP100 | KIAA0130 | MGC8748 | THRAP4 | TRAP100mediator complex subunit 24Affinity Capture-MSBioGRID15175163 
-HPRD14576168 
MED25ACID1 | ARC92 | DKFZp434K0512 | MGC70671 | P78 | PTOV2 | TCBAP0758mediator complex subunit 25Affinity Capture-MS
Affinity Capture-Western		BioGRID14638676 |15175163 
-HPRD14576168 
MED26CRSP7 | CRSP70mediator complex subunit 26-HPRD14576168 
Affinity Capture-MSBioGRID15175163 
MED27CRAP34 | CRSP34 | CRSP8 | MGC11274 | TRAP37mediator complex subunit 27-HPRD14576168 
Affinity Capture-MSBioGRID15175163 
MED281500003D12Rik | DKFZp434N185 | EG1 | magicinmediator complex subunit 28Affinity Capture-MSBioGRID15175163 
MED29DKFZp434H247 | IXLmediator complex subunit 29Affinity Capture-MS
Affinity Capture-Western		BioGRID14576168 |14638676 
|15175163 
MED30MGC9890 | THRAP6 | TRAP25mediator complex subunit 30-HPRD14576168 
Affinity Capture-MSBioGRID15175163 
MED313110004H13Rik | CGI-125 | FLJ27436 | FLJ36714 | Soh1mediator complex subunit 31-HPRD,BioGRID14576168 
MED4DRIP36 | FLJ10956 | HSPC126 | RP11-90M2.2 | TRAP36 | VDRIPmediator complex subunit 4-HPRD14576168 
Affinity Capture-MS
Affinity Capture-Western		BioGRID14638676 |15175163 
MED6NY-REN-28mediator complex subunit 6-HPRD,BioGRID14576168 
MED7CRSP33 | CRSP9 | MGC12284mediator complex subunit 7-HPRD14576168 
Affinity Capture-MSBioGRID15175163 
MED8ARC32 | MGC17544 | MGC19641mediator complex subunit 8-HPRD,BioGRID14576168 
MED9FLJ10193 | MED25 | MGC138234mediator complex subunit 9-HPRD14638676 
Affinity Capture-MSBioGRID15175163 
POLR2AMGC75453 | POLR2 | POLRA | RPB1 | RPBh1 | RPO2 | RPOL2 | RpIILS | hRPB220 | hsRPB1polymerase (RNA) II (DNA directed) polypeptide A, 220kDaAffinity Capture-MSBioGRID15175163 
POLR2BPOL2RB | RPB2 | hRPB140 | hsRPB2polymerase (RNA) II (DNA directed) polypeptide B, 140kDaAffinity Capture-MSBioGRID15175163 
POLR2CRPB3 | RPB31 | hRPB33 | hsRPB3polymerase (RNA) II (DNA directed) polypeptide C, 33kDaAffinity Capture-MSBioGRID15175163 
POLR2DHSRBP4 | HSRPB4 | RBP4polymerase (RNA) II (DNA directed) polypeptide DAffinity Capture-MSBioGRID15175163 
POLR2ERPABC1 | RPB5 | XAP4 | hRPB25 | hsRPB5polymerase (RNA) II (DNA directed) polypeptide E, 25kDaAffinity Capture-MSBioGRID15175163 
POLR2FHRBP14.4 | POLRF | RPABC2 | RPB14.4 | RPB6polymerase (RNA) II (DNA directed) polypeptide FAffinity Capture-MSBioGRID15175163 
POLR2GMGC138367 | MGC138369 | RPB7 | hRPB19 | hsRPB7polymerase (RNA) II (DNA directed) polypeptide GAffinity Capture-MSBioGRID15175163 
POLR2HRPABC3 | RPB17 | RPB8 | hsRPB8polymerase (RNA) II (DNA directed) polypeptide HAffinity Capture-MSBioGRID15175163 
POLR2IRPB9 | hRPB14.5polymerase (RNA) II (DNA directed) polypeptide I, 14.5kDaAffinity Capture-MSBioGRID15175163 
POLR2JMGC71910 | POLR2J1 | RPB11 | RPB11A | RPB11m | hRPB14polymerase (RNA) II (DNA directed) polypeptide J, 13.3kDaAffinity Capture-MSBioGRID15175163 
POLR2LRBP10 | RPABC5 | RPB10 | RPB10beta | RPB7.6 | hRPB7.6 | hsRPB10bpolymerase (RNA) II (DNA directed) polypeptide L, 7.6kDaAffinity Capture-MSBioGRID15175163 
USP47DKFZp686C13257 | FLJ20727 | TRFPubiquitin specific peptidase 47-HPRD14576168 
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-25/32/92/363/367764770m8hsa-miR-25brainCAUUGCACUUGUCUCGGUCUGA
hsa-miR-32UAUUGCACAUUACUAAGUUGC
hsa-miR-92UAUUGCACUUGUCCCGGCCUG
hsa-miR-367AAUUGCACUUUAGCAAUGGUGA
hsa-miR-92bSZUAUUGCACUCGUCCCGGCCUC
miR-370122128m8hsa-miR-370brainGCCUGCUGGGGUGGAACCUGG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.