Gene Page: ARHGAP15

Summary
GeneID  55843
Symbol  ARHGAP15
Synonyms  BM046
Description  Rho GTPase activating protein 15
See related  HGNC:21030|MIM:610578|Ensembl:ENSG00000075884|HPRD:06447|
Locus tag  -
Gene type  protein-coding
Map location  2q22.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.023 
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.02395 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005096GTPase activator activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007165signal transductionIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005622intracellularIEA-
GO:0005737cytoplasmIEA-
GO:0016020membraneIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
CD93C1QR1 | C1qR(P) | C1qRP | CDw93 | MXRA4 | dJ737E23.1CD93 moleculeCD93 interacts with BM046.BIND15459234 
RAC1MGC111543 | MIG5 | TC-25 | p21-Rac1ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)-HPRD,BioGRID12650940 
 
Pathway annotation
Pathway namePathway size# SZGR genes in pathwayInfo
REACTOME_SIGNALING_BY_RHO_GTPASES 11381All SZGR genes in this pathway
WINTER_HYPOXIA_DN 5230All SZGR genes in this pathway
DAVICIONI_TARGETS_OF_PAX_FOXO1_FUSIONS_DN 6849All SZGR genes in this pathway
SABATES_COLORECTAL_ADENOMA_DN 291176All SZGR genes in this pathway
LINDGREN_BLADDER_CANCER_CLUSTER_1_DN 378231All SZGR genes in this pathway
ROVERSI_GLIOMA_COPY_NUMBER_DN 5437All SZGR genes in this pathway
LINDGREN_BLADDER_CANCER_CLUSTER_2B 392251All SZGR genes in this pathway
PASQUALUCCI_LYMPHOMA_BY_GC_STAGE_DN 165104All SZGR genes in this pathway
STARK_PREFRONTAL_CORTEX_22Q11_DELETION_DN 517309All SZGR genes in this pathway
ZHENG_BOUND_BY_FOXP3 491310All SZGR genes in this pathway
MARSON_BOUND_BY_FOXP3_UNSTIMULATED 1229713All SZGR genes in this pathway
ZHENG_FOXP3_TARGETS_IN_THYMUS_UP 196137All SZGR genes in this pathway
AMUNDSON_POOR_SURVIVAL_AFTER_GAMMA_RADIATION_2G 17196All SZGR genes in this pathway
WALLACE_PROSTATE_CANCER_RACE_UP 299167All SZGR genes in this pathway
SMID_BREAST_CANCER_NORMAL_LIKE_UP 476285All SZGR genes in this pathway
LEE_DIFFERENTIATING_T_LYMPHOCYTE 200115All SZGR genes in this pathway
CHEN_METABOLIC_SYNDROM_NETWORK 1210725All SZGR genes in this pathway
POOLA_INVASIVE_BREAST_CANCER_UP 288168All SZGR genes in this pathway
NAKAYAMA_SOFT_TISSUE_TUMORS_PCA1_UP 7646All SZGR genes in this pathway
LI_INDUCED_T_TO_NATURAL_KILLER_DN 11683All SZGR genes in this pathway
WANG_RESPONSE_TO_GSK3_INHIBITOR_SB216763_UP 397206All SZGR genes in this pathway
PILON_KLF1_TARGETS_DN 19721213All SZGR genes in this pathway
TORCHIA_TARGETS_OF_EWSR1_FLI1_FUSION_TOP20_DN 1812All SZGR genes in this pathway
TORCHIA_TARGETS_OF_EWSR1_FLI1_FUSION_DN 321200All SZGR genes in this pathway
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-203.15662m8hsa-miR-203UGAAAUGUUUAGGACCACUAG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.