Gene Page: BARHL1

Summary
GeneID  56751
Symbol  BARHL1
Synonyms  -
Description  BarH-like homeobox 1
See related  HGNC:953|MIM:605211|Ensembl:ENSG00000125492|HPRD:05554|
Locus tag  -
Gene type  protein-coding
Map location  9q34
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003700transcription factor activityIEA-
GO:0005515protein bindingIPI17353931 
GO:0043565sequence-specific DNA bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0001764neuron migrationIEAneuron (GO term level: 8)-
GO:0006355regulation of transcription, DNA-dependentIEA-
GO:0007605sensory perception of soundIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-
GO:0005730nucleolusIDA18029348 
GO:0005737cytoplasmIDA18029348 
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
MED7CRSP33 | CRSP9 | MGC12284mediator complex subunit 7Affinity Capture-MSBioGRID17353931 
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-3634985041Ahsa-miR-363AUUGCACGGUAUCCAUCUGUAA
miR-411545551m8hsa-miR-411AACACGGUCCACUAACCCUCAGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.