Gene Page: KCMF1

Summary
GeneID  56888
Symbol  KCMF1
Synonyms  DEBT91|DKFZp434L1021|FIGC|PCMF|ZZZ1
Description  potassium channel modulatory factor 1
See related  HGNC:20589|HPRD:13761|
Locus tag  -
Gene type  protein-coding
Map location  2p11.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.0004 
ExpressionExpressionP value: 1.545 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0016874ligase activityIEA-
GO:0008270zinc ion bindingIEA-
GO:0046872metal ion bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006511ubiquitin-dependent protein catabolic processIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005622intracellularIEA-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1824046m8hsa-miR-182UUUGGCAAUGGUAGAACUCACA
miR-1941091151Ahsa-miR-194UGUAACAGCAACUCCAUGUGGA
miR-3293113171Ahsa-miR-329brainAACACACCUGGUUAACCUCUUU
miR-409-3p2662721Ahsa-miR-409-3pCGAAUGUUGCUCGGUGAACCCCU
hsa-miR-409-3pCGAAUGUUGCUCGGUGAACCCCU
miR-542-3p99105m8hsa-miR-542-3pUGUGACAGAUUGAUAACUGAAA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.