Gene Page: OLFML3

Summary
GeneID  56944
Symbol  OLFML3
Synonyms  HNOEL-iso|OLF44
Description  olfactomedin-like 3
See related  HGNC:24956|MIM:610088|Ensembl:ENSG00000116774|HPRD:14878|
Locus tag  -
Gene type  protein-coding
Map location  1p13.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.0235 
ExpressionExpressionP value: 2.184 
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.0185 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005576extracellular regionIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
CKMT2SMTCKcreatine kinase, mitochondrial 2 (sarcomeric)Two-hybridBioGRID16169070 
FEZ1-fasciculation and elongation protein zeta 1 (zygin I)Two-hybridBioGRID16169070 
HSPB3HSPL27heat shock 27kDa protein 3Two-hybridBioGRID16169070 
SETDB1ESET | KG1T | KIAA0067 | KMT1ESET domain, bifurcated 1Two-hybridBioGRID16169070 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1554614671Ahsa-miR-155UUAAUGCUAAUCGUGAUAGGGG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.