Gene Page: PLSCR3

Summary
GeneID  57048
Symbol  PLSCR3
Synonyms  -
Description  phospholipid scramblase 3
See related  HGNC:16495|MIM:607611|Ensembl:ENSG00000187838|HPRD:07400|
Locus tag  -
Gene type  protein-coding
Map location  17p13.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
ExpressionExpressionP value: 1.735 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005509calcium ion bindingNAS10930526 
GO:0017124SH3 domain bindingIEA-
GO:0017128phospholipid scramblase activityNAS10930526 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0017121phospholipid scramblingNAS10930526 
GO:0042593glucose homeostasisIEA-
GO:0042632cholesterol homeostasisIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0016021integral to membraneIEA-
GO:0005886plasma membraneNAS10930526 
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
PLSCR1MMTRA1Bphospholipid scramblase 1Two-hybridBioGRID16189514 
PRKCDMAY1 | MGC49908 | PKCD | nPKC-deltaprotein kinase C, delta-HPRD,BioGRID12649167 
TRIP1316E1BPthyroid hormone receptor interactor 13Two-hybridBioGRID16189514 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-124.1560566m8hsa-miR-124aUUAAGGCACGCGGUGAAUGCCA
miR-124/5065595661A,m8hsa-miR-506UAAGGCACCCUUCUGAGUAGA
hsa-miR-124brainUAAGGCACGCGGUGAAUGCC
miR-485-3p176182m8hsa-miR-485-3pGUCAUACACGGCUCUCCUCUCU
miR-96501507m8hsa-miR-96brainUUUGGCACUAGCACAUUUUUGC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.