Gene Page: PCNP

Summary
GeneID  57092
Symbol  PCNP
Synonyms  DKFZp781I24156
Description  PEST proteolytic signal containing nuclear protein
See related  HGNC:30023|Ensembl:ENSG00000081154|HPRD:17826|
Locus tag  -
Gene type  protein-coding
Map location  3q12.3
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_IIEgenome scan meta-analysis (European-ancestry samples)Psr: 0.04359 
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.04047 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIPI12176013 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007049cell cycleIEA-
GO:0016567protein ubiquitinationIDA14741369 
GO:0043161proteasomal ubiquitin-dependent protein catabolic processIDA14741369 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIDA12176013 
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
UHRF2DKFZp434B0920 | DKFZp686G0837 | MGC33463 | NIRF | RNF107 | URF2ubiquitin-like with PHD and ring finger domains 2-HPRD12176013 |14741369 
 
Pathway annotation
Pathway namePathway size# SZGR genes in pathwayInfo
ONKEN_UVEAL_MELANOMA_DN 526357All SZGR genes in this pathway
THUM_SYSTOLIC_HEART_FAILURE_UP 423283All SZGR genes in this pathway
DIAZ_CHRONIC_MEYLOGENOUS_LEUKEMIA_UP 1382904All SZGR genes in this pathway
BENPORATH_MYC_MAX_TARGETS 775494All SZGR genes in this pathway
SHEN_SMARCA2_TARGETS_UP 424268All SZGR genes in this pathway
WANG_TUMOR_INVASIVENESS_DN 210128All SZGR genes in this pathway
MILI_PSEUDOPODIA_HAPTOTAXIS_UP 518299All SZGR genes in this pathway
DANG_BOUND_BY_MYC 1103714All SZGR genes in this pathway
LU_EZH2_TARGETS_DN 414237All SZGR genes in this pathway
JOHNSTONE_PARVB_TARGETS_2_DN 336211All SZGR genes in this pathway
JOHNSTONE_PARVB_TARGETS_3_DN 918550All SZGR genes in this pathway
MAEKAWA_ATF2_TARGETS 2419All SZGR genes in this pathway
RAO_BOUND_BY_SALL4_ISOFORM_B 517302All SZGR genes in this pathway
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-181701707m8hsa-miR-181abrainAACAUUCAACGCUGUCGGUGAGU
hsa-miR-181bSZAACAUUCAUUGCUGUCGGUGGG
hsa-miR-181cbrainAACAUUCAACCUGUCGGUGAGU
hsa-miR-181dbrainAACAUUCAUUGUUGUCGGUGGGUU
miR-200bc/429693699m8hsa-miR-200bUAAUACUGCCUGGUAAUGAUGAC
hsa-miR-200cUAAUACUGCCGGGUAAUGAUGG
hsa-miR-429UAAUACUGUCUGGUAAAACCGU
miR-21810631069m8hsa-miR-218brainUUGUGCUUGAUCUAACCAUGU
miR-365502508m8hsa-miR-365UAAUGCCCCUAAAAAUCCUUAU
miR-4101761821Ahsa-miR-410AAUAUAACACAGAUGGCCUGU
miR-4217637691Ahsa-miR-421GGCCUCAUUAAAUGUUUGUUG
miR-4311901961Ahsa-miR-431UGUCUUGCAGGCCGUCAUGCA
miR-9681687m8hsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.