Gene Page: PDSS2

Summary
GeneID  57107
Symbol  PDSS2
Synonyms  C6orf210|DLP1|bA59I9.3|hDLP1
Description  prenyl (decaprenyl) diphosphate synthase, subunit 2
See related  HGNC:23041|MIM:610564|Ensembl:ENSG00000164494|HPRD:12879|
Locus tag  RP11-59I9.3
Gene type  protein-coding
Map location  6q21
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000010trans-hexaprenyltranstransferase activityIDA16262699 
GO:0016740transferase activityIEA-
GO:0046982protein heterodimerization activityIDA16262699 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006744ubiquinone biosynthetic processIDA16262699 
GO:0008299isoprenoid biosynthetic processIDA16262699 
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-203.1101010171A,m8hsa-miR-203UGAAAUGUUUAGGACCACUAG
miR-488141014171A,m8hsa-miR-488CCCAGAUAAUGGCACUCUCAA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.