Gene Page: AMIGO1

Summary
GeneID  57463
Symbol  AMIGO1
Synonyms  AMIGO
Description  adhesion molecule with Ig-like domain 1
See related  HGNC:20824|Ensembl:ENSG00000181754|HPRD:11129|
Locus tag  -
Gene type  protein-coding
Map location  1p13.3
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 4 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingISS-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007413axonal fasciculationISSneuron, axon (GO term level: 13)12629050 
GO:0042552myelinationISSneuron, axon, Brain, oligodendrocyte (GO term level: 13)12629050 
GO:0050772positive regulation of axonogenesisISSaxon, neurogenesis (GO term level: 14)12629050 
GO:0007399nervous system developmentIEAneurite (GO term level: 5)-
GO:0007155cell adhesionIEA-
GO:0007156homophilic cell adhesionISS12629050 
GO:0007157heterophilic cell adhesionISS12629050 
GO:0007275multicellular organismal developmentIEA-
GO:0030154cell differentiationIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0016020membraneIEA-
GO:0016021integral to membraneIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
AMIGO1AMIGOadhesion molecule with Ig-like domain 1Affinity Capture-WesternBioGRID12629050 
AMIGO2ALI1 | DEGAadhesion molecule with Ig-like domain 2-HPRD,BioGRID12629050 
AMIGO3MGC120552adhesion molecule with Ig-like domain 3-HPRD,BioGRID12629050 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-28341347m8hsa-miR-28brainAAGGAGCUCACAGUCUAUUGAG
miR-431144150m8hsa-miR-431UGUCUUGCAGGCCGUCAUGCA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.