Gene Page: KLHL1

Summary
GeneID  57626
Symbol  KLHL1
Synonyms  FLJ30047|KIAA1490|MRP2
Description  kelch-like 1 (Drosophila)
See related  HGNC:6352|MIM:605332|Ensembl:ENSG00000150361|HPRD:05623|
Locus tag  RP11-394C23.1
Gene type  protein-coding
Map location  13q21
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 4 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003779actin bindingNAS10888605 
GO:0005515protein bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0021680cerebellar Purkinje cell layer developmentIEAneuron, axon, Synap, dendrite (GO term level: 12)-
GO:0016358dendrite developmentIEAneurite, dendrite (GO term level: 11)-
GO:0007628adult walking behaviorIEA-
GO:0007626locomotory behaviorIEA-
GO:0030036actin cytoskeleton organizationNAS10888605 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0043025cell somaIEAaxon, dendrite (GO term level: 4)-
GO:0030425dendriteIEAneuron, axon, dendrite (GO term level: 6)-
GO:0005856cytoskeletonIEA-
GO:0005737cytoplasmNAS10888605 
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-247277341A,m8hsa-miR-24SZUGGCUCAGUUCAGCAGGAACAG
miR-4526696751Ahsa-miR-452UGUUUGCAGAGGAAACUGAGAC
miR-496106110681A,m8hsa-miR-496AUUACAUGGCCAAUCUC
miR-97327381Ahsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA
hsa-miR-9SZUCUUUGGUUAUCUAGCUGUAUGA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.