|
GeneID |
57863
|
Symbol |
CADM3
|
Synonyms |
BIgR|FLJ10698|IGSF4B|NECL1|Necl-1|TSLL1|synCAM3
|
Description |
cell adhesion molecule 3 |
See related |
HGNC:17601|MIM:609743|Ensembl:ENSG00000162706|HPRD:13733| |
Locus tag |
CTA-134P22.1 |
Gene type |
protein-coding |
Map location |
1q21.2-q22 |
|
|
|
Gene set name |
Method of gene set |
Evidence |
Info |
GSMA_I | genome scan meta-analysis | Psr: 0.0235 | | GSMA_IIA | genome scan meta-analysis (All samples) | Psr: 0.00814 | | Literature | High-throughput literature-search | Co-occurance with Schizophrenia keywords: [schizophrenias, schizophrenic, schizophrenia] | Click to show detail |
|
|
General Gene Expression (microarray) ? |
|
|
|
Gene Expression in Brain Regions (new) |
|
|
Top co-expressed genes in Brain Regions (new) |
|
Gene | Pearson's Correlation | Spearman's Correlation | | |
Top 10 positively co-expressed genes |
Top 10 negatively co-expressed genes | |
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|
GO:0005509 | calcium ion binding | IEA | | - |
GO:0005515 | protein binding | ISS | | 12826663 |
GO:0042803 | protein homodimerization activity | ISS | | 12826663 |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
---|
GO:0007155 | cell adhesion | IEA | | - |
GO:0007156 | homophilic cell adhesion | ISS | | 12826663 |
GO:0007157 | heterophilic cell adhesion | ISS | | 12826663 |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
---|
GO:0016021 | integral to membrane | IEA | | - |
GO:0005911 | cell-cell junction | ISS | | 12826663 |
GO:0005886 | plasma membrane | IEA | | - |
|
|
miR-330 | 143 | 149 | m8 | hsa-miR-330brain | GCAAAGCACACGGCCUGCAGAGA | miR-346 | 1049 | 1056 | 1A,m8 | hsa-miR-346brain | UGUCUGCCCGCAUGCCUGCCUCU |
|
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.
|