Gene Page: RAP1GDS1

Summary
GeneID  5910
Symbol  RAP1GDS1
Synonyms  GDS1|MGC118859|MGC118861|SmgGDS
Description  RAP1, GTP-GDP dissociation stimulator 1
See related  HGNC:9859|MIM:179502|Ensembl:ENSG00000138698|HPRD:11763|
Locus tag  -
Gene type  protein-coding
Map location  4q23-q25
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
ExpressionExpressionP value: 1.839 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005096GTPase activator activityNAS1549351 
GO:0005488bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0008150biological_processND-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005575cellular_componentND-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
HRASC-BAS/HAS | C-H-RAS | C-HA-RAS1 | CTLO | H-RASIDX | HAMSV | HRAS1 | K-RAS | N-RAS | RASH1v-Ha-ras Harvey rat sarcoma viral oncogene homolog-HPRD,BioGRID11948427 
KIFAP3FLJ22818 | KAP3 | SMAP | Smg-GDS | dJ190I16.1kinesin-associated protein 3-HPRD,BioGRID8900189 
KRASC-K-RAS | K-RAS2A | K-RAS2B | K-RAS4A | K-RAS4B | KI-RAS | KRAS1 | KRAS2 | NS3 | RASK2v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog-HPRD,BioGRID11948427 
MBIP-MAP3K12 binding inhibitory protein 1Two-hybridBioGRID16189514 
NRASALPS4 | N-ras | NRAS1neuroblastoma RAS viral (v-ras) oncogene homolog-HPRD,BioGRID11948427 
RAC1MGC111543 | MIG5 | TC-25 | p21-Rac1ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)-HPRD,BioGRID11948427 
RAP1AKREV-1 | KREV1 | RAP1 | SMGP21RAP1A, member of RAS oncogene family-HPRD,BioGRID11948427 
RHOAARH12 | ARHA | RHO12 | RHOH12ras homolog gene family, member A-HPRD,BioGRID11948427 
ZNF451COASTER | FLJ23421 | FLJ53246 | FLJ90693 | KIAA0576 | KIAA1702 | MGC26701 | dJ417I1.1zinc finger protein 451Two-hybridBioGRID16189514 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-29428434m8hsa-miR-29aSZUAGCACCAUCUGAAAUCGGUU
hsa-miR-29bSZUAGCACCAUUUGAAAUCAGUGUU
hsa-miR-29cSZUAGCACCAUUUGAAAUCGGU
miR-3703683751A,m8hsa-miR-370brainGCCUGCUGGGGUGGAACCUGG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.