Gene Page: RAPSN

Summary
GeneID  5913
Symbol  RAPSN
Synonyms  CMS1D|CMS1E|MGC3597|RNF205
Description  receptor-associated protein of the synapse
See related  HGNC:9863|MIM:601592|Ensembl:ENSG00000165917|HPRD:03353|
Locus tag  -
Gene type  protein-coding
Map location  11p11.2-p11.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 2 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIEA-
GO:0008270zinc ion bindingIEA-
GO:0033130acetylcholine receptor bindingIEA-
GO:0046872metal ion bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007268synaptic transmissionTASneuron, Synap, Neurotransmitter (GO term level: 6)8812503 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0031594neuromuscular junctionIEAneuron, axon, Synap, Neurotransmitter (GO term level: 3)-
GO:0045211postsynaptic membraneIEASynap, Neurotransmitter (GO term level: 5)-
GO:0005794Golgi apparatusIEA-
GO:0005856cytoskeletonIEA-
GO:0005737cytoplasmIEA-
GO:0005886plasma membraneIEA-
GO:0030054cell junctionIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
DAG1156DAG | A3a | AGRNR | DAGdystroglycan 1 (dystrophin-associated glycoprotein 1)-HPRD,BioGRID7619516|11342559 
GRB2ASH | EGFRBP-GRB2 | Grb3-3 | MST084 | MSTP084growth factor receptor-bound protein 2-HPRD9856458 
KHDRBS1FLJ34027 | Sam68 | p62KH domain containing, RNA binding, signal transduction associated 1-HPRD,BioGRID9804166 
MUSKMGC126323 | MGC126324muscle, skeletal, receptor tyrosine kinase-HPRD9136771 
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-142-5p1811871Ahsa-miR-142-5pCAUAAAGUAGAAAGCACUAC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.