Gene Page: CPLX3

Summary
GeneID  594855
Symbol  CPLX3
Synonyms  CPX-III|CPXIII|FLJ13993|Nbla11589
Description  complexin 3
See related  HGNC:27652|MIM:609585|Ensembl:ENSG00000213578|
Locus tag  -
Gene type  protein-coding
Map location  15q24.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 4 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0019905syntaxin bindingIEASynap (GO term level: 5)-
GO:0005326neurotransmitter transporter activityIEAneuron, Neurotransmitter (GO term level: 3)-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0046928regulation of neurotransmitter secretionIEASynap, Neurotransmitter (GO term level: 9)-
GO:0016079synaptic vesicle exocytosisIEAneuron, Synap, Neurotransmitter (GO term level: 9)-
GO:0006836neurotransmitter transportIEAneuron, Neurotransmitter (GO term level: 5)-
GO:0030073insulin secretionIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0045202synapseIEAneuron, Synap, Neurotransmitter, Glial (GO term level: 2)-
GO:0005829cytosolIEA-
GO:0005886plasma membraneIEA-
GO:0030054cell junctionIEA-
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-148/1527387441Ahsa-miR-148aUCAGUGCACUACAGAACUUUGU
hsa-miR-152brainUCAGUGCAUGACAGAACUUGGG
hsa-miR-148bUCAGUGCAUCACAGAACUUUGU
miR-3427067131A,m8hsa-miR-342brainUCUCACACAGAAAUCGCACCCGUC
miR-377705711m8hsa-miR-377AUCACACAAAGGCAACUUUUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.