Gene Page: RNH1

Summary
GeneID  6050
Symbol  RNH1
Synonyms  MGC18200|MGC4569|MGC54054|RAI|RNH
Description  ribonuclease/angiogenin inhibitor 1
See related  HGNC:10074|MIM:173320|Ensembl:ENSG00000023191|HPRD:01412|
Locus tag  -
Gene type  protein-coding
Map location  11p15.5
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIEA-
GO:0005515protein bindingIPI2742853 |3064806 |3470787 
GO:0008428ribonuclease inhibitor activityIDA3470787 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006402mRNA catabolic processNAS2081593 
GO:0045765regulation of angiogenesisIDA3470787 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005737cytoplasmIEA-
GO:0032311angiogenin-PRI complexIPI3470787 
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ANGALS9 | HEL168 | MGC22466 | MGC71966 | RNASE4 | RNASE5angiogenin, ribonuclease, RNase A family, 5-HPRD,BioGRID2276743 |2742853 
|9311977 
RNASE1MGC12408 | RIB1 | RNS1ribonuclease, RNase A family, 1 (pancreatic)-HPRD9311977 |11342552 
-HPRD9311977 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-142-5p1461531A,m8hsa-miR-142-5pCAUAAAGUAGAAAGCACUAC
miR-17-5p/20/93.mr/106/519.d1451511Ahsa-miR-17-5pCAAAGUGCUUACAGUGCAGGUAGU
hsa-miR-20abrainUAAAGUGCUUAUAGUGCAGGUAG
hsa-miR-106aAAAAGUGCUUACAGUGCAGGUAGC
hsa-miR-106bSZUAAAGUGCUGACAGUGCAGAU
hsa-miR-20bSZCAAAGUGCUCAUAGUGCAGGUAG
hsa-miR-519dCAAAGUGCCUCCCUUUAGAGUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.