Gene Page: RIC8A

Summary
GeneID  60626
Symbol  RIC8A
Synonyms  MGC104517|MGC131931|MGC148073|MGC148074|RIC8|synembryn
Description  resistance to inhibitors of cholinesterase 8 homolog A (C. elegans)
See related  HGNC:29550|MIM:609146|Ensembl:ENSG00000177963|HPRD:12373|
Locus tag  -
Gene type  protein-coding
Map location  11p15.5
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.0073 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005085guanyl-nucleotide exchange factor activityIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005737cytoplasmIEA-
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
GNA13G13 | MGC46138guanine nucleotide binding protein (G protein), alpha 13-HPRD,BioGRID12509430 
GNAI1Giguanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1-HPRD,BioGRID12509430 
GNAI2GIP | GNAI2B | H_LUCA15.1 | H_LUCA16.1guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2-HPRD,BioGRID12509430 
GNAI387U6 | FLJ26559guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3-HPRD,BioGRID12509430 
GNAO1DKFZp686O0962 | G-ALPHA-o | GNAOguanine nucleotide binding protein (G protein), alpha activating activity polypeptide O-HPRD,BioGRID12509430 
GNAQG-ALPHA-q | GAQguanine nucleotide binding protein (G protein), q polypeptide-HPRD,BioGRID12509430 |12652642 
GNASAHO | C20orf45 | GNAS1 | GPSA | GSA | GSP | MGC33735 | PHP1A | PHP1B | POH | dJ309F20.1.1 | dJ806M20.3.3GNAS complex locus-HPRD,BioGRID12652642 
MAPK8IP3DKFZp762N1113 | FLJ00027 | JIP3 | JSAP1 | KIAA1066 | SYD2mitogen-activated protein kinase 8 interacting protein 3Two-hybridBioGRID16169070 
TERF1FLJ41416 | PIN2 | TRBF1 | TRF | TRF1 | hTRF1-AS | t-TRF1telomeric repeat binding factor (NIMA-interacting) 1Two-hybridBioGRID16169070 
TUBB2ATUBB | TUBB2 | dJ40E16.7tubulin, beta 2ATwo-hybridBioGRID16169070 
UBQLN1DA41 | DSK2 | FLJ90054 | PLIC-1 | XDRP1ubiquilin 1Two-hybridBioGRID16189514 
ZNF585BFLJ14928 | SZFP41zinc finger protein 585BTwo-hybridBioGRID16169070 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-293339m8hsa-miR-29aSZUAGCACCAUCUGAAAUCGGUU
hsa-miR-29bSZUAGCACCAUUUGAAAUCAGUGUU
hsa-miR-29cSZUAGCACCAUUUGAAAUCGGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.