Gene Page: PROK2

Summary
GeneID  60675
Symbol  PROK2
Synonyms  BV8|KAL4|MIT1|PK2
Description  prokineticin 2
See related  HGNC:18455|MIM:607002|Ensembl:ENSG00000163421|HPRD:08446|
Locus tag  -
Gene type  protein-coding
Map location  3p13
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.04047 
GSMA_IIEgenome scan meta-analysis (European-ancestry samples)Psr: 0.04359 
ExpressionExpressionP value: 1.597 
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0001664G-protein-coupled receptor bindingTAS12728244 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007218neuropeptide signaling pathwayIEANeurotransmitter (GO term level: 8)-
GO:0000187activation of MAPK activityTAS12728244 
GO:0001525angiogenesisIDA12604792 
GO:0007204elevation of cytosolic calcium ion concentrationTAS12728244 
GO:0007283spermatogenesisIMP10580115 
GO:0008283cell proliferationIDA12604792 
GO:0006954inflammatory responseNAS11259612 
GO:0006935chemotaxisIDA12604792 
GO:0006916anti-apoptosisIDA12604792 
GO:0019233sensory perception of painTAS12728244 
GO:0045987positive regulation of smooth muscle contractionIDA11259612 
GO:0048511rhythmic processIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005576extracellular regionTAS12466223 
 
Pathway annotation
Pathway namePathway size# SZGR genes in pathwayInfo
BENPORATH_SUZ12_TARGETS 1038678All SZGR genes in this pathway
BENPORATH_EED_TARGETS 1062725All SZGR genes in this pathway
BENPORATH_ES_WITH_H3K27ME3 1118744All SZGR genes in this pathway
BENPORATH_PRC2_TARGETS 652441All SZGR genes in this pathway
MARZEC_IL2_SIGNALING_DN 3624All SZGR genes in this pathway
VART_KSHV_INFECTION_ANGIOGENIC_MARKERS_DN 13892All SZGR genes in this pathway
MEISSNER_BRAIN_HCP_WITH_H3K4ME3_AND_H3K27ME3 1069729All SZGR genes in this pathway
MEISSNER_NPC_HCP_WITH_H3K4ME2_AND_H3K27ME3 349234All SZGR genes in this pathway
MIKKELSEN_NPC_HCP_WITH_H3K27ME3 341243All SZGR genes in this pathway
KUMAR_PATHOGEN_LOAD_BY_MACROPHAGES 275155All SZGR genes in this pathway
KUMAR_AUTOPHAGY_NETWORK 7146All SZGR genes in this pathway
ZWANG_TRANSIENTLY_UP_BY_2ND_EGF_PULSE_ONLY 1725838All SZGR genes in this pathway
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-369-3p104810541Ahsa-miR-369-3pAAUAAUACAUGGUUGAUCUUU
miR-37410481054m8hsa-miR-374UUAUAAUACAACCUGAUAAGUG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.