|
GeneID |
631
|
Symbol |
BFSP1
|
Synonyms |
CP115|CP94|FILENSIN|LIFL-H
|
Description |
beaded filament structural protein 1, filensin |
See related |
HGNC:1040|MIM:603307|Ensembl:ENSG00000125864|HPRD:04494| |
Locus tag |
RP4-531H16.2 |
Gene type |
protein-coding |
Map location |
20p11.23-p12.1 |
|
|
|
Gene set name |
Method of gene set |
Evidence |
Info |
GSMA_I | genome scan meta-analysis | Psr: 0.046 | |
|
|
General Gene Expression (microarray) ? |
|
|
|
Gene Expression in Brain Regions (new) |
|
|
Top co-expressed genes in Brain Regions (new) |
|
Gene | Pearson's Correlation | Spearman's Correlation | | |
Top 10 positively co-expressed genes |
ICAM1 | 0.52 | 0.44 | | |
ZC3H12A | 0.50 | 0.40 | | |
BTG2 | 0.49 | 0.42 | | |
TBX2 | 0.48 | 0.47 | | |
LRRC32 | 0.48 | 0.47 | | |
FOXF1 | 0.47 | 0.35 | | |
TINAGL1 | 0.47 | 0.47 | | |
ADAMTS1 | 0.47 | 0.39 | | |
FGR | 0.47 | 0.48 | | |
FAM38A | 0.47 | 0.47 | | |
Top 10 negatively co-expressed genes | C3orf14 | -0.37 | -0.37 | | |
POLB | -0.37 | -0.39 | | |
MMADHC | -0.37 | -0.38 | | |
C11orf57 | -0.37 | -0.39 | | |
RBM34 | -0.37 | -0.41 | | |
PSMD14 | -0.37 | -0.36 | | |
RP11-63L7.1 | -0.37 | -0.35 | | |
UBE2D2 | -0.36 | -0.37 | | |
TXNL1 | -0.36 | -0.38 | | |
METTL9 | -0.36 | -0.37 | | |
|
Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
---|
GO:0005515 | protein binding | NAS | | - |
GO:0005200 | structural constituent of cytoskeleton | TAS | | 9628810 |
GO:0005212 | structural constituent of eye lens | NAS | | - |
Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
---|
GO:0008150 | biological_process | ND | | - |
Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
---|
GO:0005856 | cytoskeleton | IEA | | - |
GO:0005882 | intermediate filament | NAS | | - |
GO:0005737 | cytoplasm | IEA | | - |
GO:0016020 | membrane | IEA | | - |
|
|
|
|
|
miR-330 | 52 | 59 | 1A,m8 | hsa-miR-330brain | GCAAAGCACACGGCCUGCAGAGA |
|
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.
|