Gene Page: NAPB

Summary
GeneID  63908
Symbol  NAPB
Synonyms  MGC26066|MGC48335|SNAP-BETA|SNAPB
Description  N-ethylmaleimide-sensitive factor attachment protein, beta
See related  HGNC:15751|MIM:611270|Ensembl:ENSG00000125814|HPRD:17627|
Locus tag  RP3-322G13.2
Gene type  protein-coding
Map location  20p12.3-p11.21
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 1 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0019905syntaxin bindingIEASynap (GO term level: 5)-
GO:0005488bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006886intracellular protein transportIEA-
GO:0016192vesicle-mediated transportIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005794Golgi apparatusIEA-
GO:0005783endoplasmic reticulumIEA-
GO:0016020membraneIEA-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-19256125681A,m8hsa-miR-19aUGUGCAAAUCUAUGCAAAACUGA
hsa-miR-19bUGUGCAAAUCCAUGCAAAACUGA
miR-200bc/42925542560m8hsa-miR-200bUAAUACUGCCUGGUAAUGAUGAC
hsa-miR-200cUAAUACUGCCGGGUAAUGAUGG
hsa-miR-429UAAUACUGUCUGGUAAAACCGU
miR-37725202526m8hsa-miR-377AUCACACAAAGGCAACUUUUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.