Gene Page: NFKBIZ

Summary
GeneID  64332
Symbol  NFKBIZ
Synonyms  FLJ30225|FLJ34463|IKBZ|INAP|MAIL
Description  nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta
See related  HGNC:29805|MIM:608004|Ensembl:ENSG00000144802|HPRD:09217|
Locus tag  -
Gene type  protein-coding
Map location  3p12-q12
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_IIEgenome scan meta-analysis (European-ancestry samples)Psr: 0.04359 
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.04047 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006355regulation of transcription, DNA-dependentIEA-
GO:0006350transcriptionIEA-
GO:0006954inflammatory responseIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
NFKB1DKFZp686C01211 | EBP-1 | KBF1 | MGC54151 | NF-kappa-B | NFKB-p105 | NFKB-p50 | p105nuclear factor of kappa light polypeptide gene enhancer in B-cells 1Affinity Capture-WesternBioGRID11356851 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-369-3p1321381Ahsa-miR-369-3pAAUAAUACAUGGUUGAUCUUU
miR-374132138m8hsa-miR-374UUAUAAUACAACCUGAUAAGUG
miR-3761051121A,m8hsa-miR-376aAUCAUAGAGGAAAAUCCACGU
hsa-miR-376bAUCAUAGAGGAAAAUCCAUGUU
miR-4101341401Ahsa-miR-410AAUAUAACACAGAUGGCCUGU
miR-488213219m8hsa-miR-488CCCAGAUAAUGGCACUCUCAA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.