Gene Page: IL25

Summary
GeneID  64806
Symbol  IL25
Synonyms  IL-17E|IL-25|IL17E
Description  interleukin 25
See related  HGNC:13765|MIM:605658|Ensembl:ENSG00000166090|HPRD:05742|
Locus tag  -
Gene type  protein-coding
Map location  14q11.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.047 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005125cytokine activityIEA-
GO:0030380interleukin-17E receptor bindingTAS11058597 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0008150biological_processND-
GO:0006954inflammatory responseIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005576extracellular regionIEA-
GO:0005615extracellular spaceIEA-
GO:0016020membraneNAS-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
IL17RBCRL4 | EVI27 | IL17BR | IL17RH1 | MGC5245interleukin 17 receptor B-HPRD,BioGRID11058597 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-17-5p/20/93.mr/106/519.d325331m8hsa-miR-17-5pCAAAGUGCUUACAGUGCAGGUAGU
hsa-miR-20abrainUAAAGUGCUUAUAGUGCAGGUAG
hsa-miR-106aAAAAGUGCUUACAGUGCAGGUAGC
hsa-miR-106bSZUAAAGUGCUGACAGUGCAGAU
hsa-miR-20bSZCAAAGUGCUCAUAGUGCAGGUAG
hsa-miR-519dCAAAGUGCCUCCCUUUAGAGUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.