|
|
| GeneID |
6572
|
| Symbol |
SLC18A3
|
| Synonyms |
MGC12716|VACHT
|
| Description |
solute carrier family 18 (vesicular acetylcholine), member 3 |
| See related |
HGNC:10936|MIM:600336|Ensembl:ENSG00000187714|HPRD:08979| |
| Locus tag |
- |
| Gene type |
protein-coding |
| Map location |
10q11.2 |
|
| |
|
|
| Gene set name |
Method of gene set |
Evidence |
Info |
| GO_Annotation | Mapping neuro-related keywords to Gene Ontology annotations | Hits with neuro-related keywords: 2 | |
|
| |
| General Gene Expression (microarray) ? |
|
 |
| |
| Gene Expression in Brain Regions (new) |
|
| |
| Top co-expressed genes in Brain Regions (new) |
|
| Gene | Pearson's Correlation | Spearman's Correlation | | |
| Top 10 positively co-expressed genes |
| NECAP1 | 0.84 | 0.81 | | |
| TM2D2 | 0.84 | 0.79 | | |
| TM2D3 | 0.84 | 0.81 | | |
| RNF41 | 0.83 | 0.83 | | |
| AC011479.2 | 0.82 | 0.78 | | |
| VPS4A | 0.82 | 0.80 | | |
| RRAGA | 0.82 | 0.80 | | |
| USP5 | 0.82 | 0.81 | | |
| PSMD7 | 0.82 | 0.80 | | |
| PGRMC1 | 0.82 | 0.82 | | |
Top 10 negatively co-expressed genes | | AF347015.26 | -0.66 | -0.59 | | |
| AF347015.2 | -0.66 | -0.57 | | |
| MT-CO2 | -0.64 | -0.56 | | |
| AF347015.8 | -0.63 | -0.57 | | |
| AF347015.33 | -0.63 | -0.57 | | |
| MT-CYB | -0.61 | -0.55 | | |
| AF347015.18 | -0.61 | -0.60 | | |
| AF347015.15 | -0.60 | -0.55 | | |
| NOSTRIN | -0.60 | -0.56 | | |
| AF347015.31 | -0.60 | -0.55 | | |
|
| Molecular function | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0005277 | acetylcholine transmembrane transporter activity | TAS | Synap, Neurotransmitter (GO term level: 6) | 8071310 |
| GO:0005215 | transporter activity | IEA | | - |
| Biological process | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0015870 | acetylcholine transport | TAS | Synap, Neurotransmitter (GO term level: 6) | 8071310 |
| Cellular component | GO term | Evidence | Neuro keywords | PubMed ID |
|---|
| GO:0005624 | membrane fraction | TAS | | 8071310 |
| GO:0016020 | membrane | IEA | | - |
| GO:0005887 | integral to plasma membrane | TAS | | 8071310 |
| |
|
| miR-96 | 315 | 322 | 1A,m8 | hsa-miR-96brain | UUUGGCACUAGCACAUUUUUGC |
|
- SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
- Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.
|
