Gene Page: TAC3

Summary
GeneID  6866
Symbol  TAC3
Synonyms  NKB|NKNB|PRO1155|ZNEUROK1
Description  tachykinin 3
See related  HGNC:11521|MIM:162330|Ensembl:ENSG00000166863|HPRD:08877|
Locus tag  -
Gene type  protein-coding
Map location  12q13-q21
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 2 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005102receptor bindingTASNeurotransmitter (GO term level: 4)10866201 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007218neuropeptide signaling pathwayIEANeurotransmitter (GO term level: 8)-
GO:0007217tachykinin signaling pathwayIEA-
GO:0007217tachykinin signaling pathwayTAS10866201 
GO:0007565female pregnancyTAS10866201 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005576extracellular regionIEA-
GO:0005615extracellular spaceTAS10866201 
GO:0005625soluble fractionTAS10866201 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
CCDC90BMDS011 | MDS025 | MGC104239coiled-coil domain containing 90BTwo-hybridBioGRID16169070 
FEZ1-fasciculation and elongation protein zeta 1 (zygin I)Two-hybridBioGRID16169070 
GPRASP1GASP | GASP1 | KIAA0443G protein-coupled receptor associated sorting protein 1Two-hybridBioGRID16169070 
IKBKAPDKFZp781H1425 | DYS | ELP1 | FD | FLJ12497 | IKAP | IKI3 | TOT1inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated proteinTwo-hybridBioGRID16169070 
PTNHARP | HBGF8 | HBNF | NEGF1pleiotrophinTwo-hybridBioGRID16169070 
TAC1Hs.2563 | NK2 | NKNA | NPK | TAC2tachykinin, precursor 1-HPRD8702757 
TACR1NK1R | NKIR | SPR | TAC1Rtachykinin receptor 1-HPRD12727971 
TACR2NK2R | NKNAR | SKR | TAC2Rtachykinin receptor 2-HPRD,BioGRID7961636 |10189055 
TACR3MGC148060 | MGC148061 | NK3R | TAC3RLtachykinin receptor 3-HPRD8990205 |10189055|10866201 
-HPRD8990205 |10189055 
UBR1JBS | MGC142065 | MGC142067ubiquitin protein ligase E3 component n-recognin 1Two-hybridBioGRID16169070 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-3203541m8hsa-miR-320AAAAGCUGGGUUGAGAGGGCGAA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.