Gene Page: TBX15

Summary
GeneID  6913
Symbol  TBX15
Synonyms  TBX14
Description  T-box 15
See related  HGNC:11594|MIM:604127|Ensembl:ENSG00000092607|HPRD:16035|
Locus tag  RP4-794L19.1
Gene type  protein-coding
Map location  1p11.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.0235 
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.00814 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0003700transcription factor activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006355regulation of transcription, DNA-dependentIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-2051731791Ahsa-miR-205UCCUUCAUUCCACCGGAGUCUG
miR-21816481654m8hsa-miR-218brainUUGUGCUUGAUCUAACCAUGU
miR-431805811m8hsa-miR-431UGUCUUGCAGGCCGUCAUGCA
miR-485-3p158715941A,m8hsa-miR-485-3pGUCAUACACGGCUCUCCUCUCU
miR-496157715831Ahsa-miR-496AUUACAUGGCCAAUCUC
miR-500141114171Ahsa-miR-500AUGCACCUGGGCAAGGAUUCUG
miR-9616431649m8hsa-miR-96brainUUUGGCACUAGCACAUUUUUGC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.