Gene Page: TGFB2

Summary
GeneID  7042
Symbol  TGFB2
Synonyms  MGC116892|TGF-beta2
Description  transforming growth factor, beta 2
See related  HGNC:11768|MIM:190220|Ensembl:ENSG00000092969|HPRD:01828|
Locus tag  -
Gene type  protein-coding
Map location  1q41
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GO_AnnotationMapping neuro-related keywords to Gene Ontology annotationsHits with neuro-related keywords: 9 
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.0104 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0001540beta-amyloid bindingIDA16227582 
GO:0004702receptor signaling protein serine/threonine kinase activityIDA12958365 
GO:0005114type II transforming growth factor beta receptor bindingIDA11157754 
GO:0005125cytokine activityTAS9611771 
GO:0005160transforming growth factor beta receptor bindingIEA-
GO:0008083growth factor activityIEA-
GO:0042803protein homodimerization activityIDA2119582 
GO:0046982protein heterodimerization activityTAS9611771 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007411axon guidanceIEAaxon (GO term level: 13)-
GO:0048699generation of neuronsTASneuron, neurogenesis (GO term level: 7)15944186 
GO:0048666neuron developmentISSneuron (GO term level: 9)-
GO:0048663neuron fate commitmentIEAneuron (GO term level: 9)-
GO:0008347glial cell migrationIDAneuron, Glial (GO term level: 8)18431253 
GO:0043525positive regulation of neuron apoptosisIDAneuron (GO term level: 9)16227582 
GO:0042416dopamine biosynthetic processISSNeurotransmitter, dopamine (GO term level: 9)-
GO:0001568blood vessel developmentIEA-
GO:0000902cell morphogenesisIDA15896309 
GO:0001525angiogenesisTAS9611771 
GO:0001666response to hypoxiaIMP12411310 
GO:0001501skeletal system developmentIEA-
GO:0001654eye developmentIDA15944186 
GO:0003007heart morphogenesisIDA10092230 
GO:0001837epithelial to mesenchymal transitionTAS14679171 
GO:0001974blood vessel remodelingIEA-
GO:0007184SMAD protein nuclear translocationIDA17192487 
GO:0006468protein amino acid phosphorylationIDA18358889 
GO:0016049cell growthIEA-
GO:0008219cell deathIDA16227582 
GO:0007267cell-cell signalingTAS3322813 
GO:0010634positive regulation of epithelial cell migrationIDA17960115 
GO:0007050cell cycle arrestIDA18223299 
GO:0008284positive regulation of cell proliferationIDA15896309 
GO:0048103somatic stem cell divisionISS-
GO:0009790embryonic developmentTAS2119582 
GO:0007435salivary gland morphogenesisIEP18080134 
GO:0014068positive regulation of phosphoinositide 3-kinase cascadeIDA18223299 
GO:0042060wound healingISS-
GO:0031069hair follicle morphogenesisISS-
GO:0030199collagen fibril organizationIDA16891397 
GO:0032909regulation of transforming growth factor-beta2 productionIMP12411310 
GO:0030308negative regulation of cell growthIDA18358889 
GO:0030307positive regulation of cell growthIDA15896309 
GO:0030593neutrophil chemotaxisISS-
GO:0030593neutrophil chemotaxisTAS9611771 
GO:0032874positive regulation of stress-activated MAPK cascadeIDA17192487 
GO:0032147activation of protein kinase activityIDA17192487 |17960115 
GO:0033630positive regulation of cell adhesion mediated by integrinIDA17960115 |18223299 
GO:0030097hemopoiesisISS-
GO:0045778positive regulation of ossificationIEP17401695 
GO:0045726positive regulation of integrin biosynthetic processIDA17960115 
GO:0050680negative regulation of epithelial cell proliferationIDA17217916 
GO:0050680negative regulation of epithelial cell proliferationIMP16943770 
GO:0050777negative regulation of immune responseTAS9611771 
GO:0050778positive regulation of immune responseISS-
GO:0045787positive regulation of cell cycleISS-
GO:0045823positive regulation of heart contractionIDA15896309 
GO:0051795positive regulation of catagenIDA15955085 
GO:0051891positive regulation of cardioblast differentiationIDA15896309 
GO:0060038cardiac muscle cell proliferationIDA15896309 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0043025cell somaISSaxon, dendrite (GO term level: 4)-
GO:0030424axonISSneuron, axon, Neurotransmitter (GO term level: 6)-
GO:0005576extracellular regionEXP3457014 
GO:0005576extracellular regionIDA16227582 
GO:0005576extracellular regionTAS2119582 
GO:0031093platelet alpha granule lumenEXP3457014 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
APPAAA | ABETA | ABPP | AD1 | APPI | CTFgamma | CVAP | PN2amyloid beta (A4) precursor proteinTGF-beta-2 interacts with Amyloid-beta. This interaction was modelled on a demonstrated interaction between TGF-beta-2 from an unspecified species and consensus Amyloid-beta peptides.BIND12867422 
BMP2BMP2Abone morphogenetic protein 2-HPRD9493905 
CTGFCCN2 | HCS24 | IGFBP8 | MGC102839 | NOV2connective tissue growth factor-HPRD,BioGRID10457363 
DAXXBING2 | DAP6 | EAP1 | MGC126245 | MGC126246death-domain associated proteinReconstituted ComplexBioGRID11483955 
DCNCSCD | DSPG2 | PG40 | PGII | PGS2 | SLRR1BdecorinReconstituted ComplexBioGRID9675033 
ENGCD105 | END | FLJ41744 | HHT1 | ORW | ORW1endoglin-HPRD12015308 
FMODSLRR2Efibromodulin-HPRD8093006 
LTBP3DKFZp586M2123 | FLJ33431 | FLJ39893 | FLJ42533 | FLJ44138 | LTBP-3 | LTBP2 | pp6425latent transforming growth factor beta binding protein 3-HPRD12062452 
PZPCPAMD6 | MGC133093pregnancy-zone protein-HPRD,BioGRID7513640 
TGFB1CED | DPD1 | TGFB | TGFbetatransforming growth factor, beta 1Two-hybridBioGRID11483955 
-HPRD11157754 
TGFB2MGC116892 | TGF-beta2transforming growth factor, beta 2-HPRD11157754 
TGFB3ARVD | FLJ16571 | TGF-beta3transforming growth factor, beta 3-HPRD11157754 
TGFBR1AAT5 | ACVRLK4 | ALK-5 | ALK5 | LDS1A | LDS2A | SKR4 | TGFR-1transforming growth factor, beta receptor 1-HPRD11157754 
TGFBR2AAT3 | FAA3 | LDS1B | LDS2B | MFS2 | RIIC | TAAD2 | TGFR-2 | TGFbeta-RIItransforming growth factor, beta receptor II (70/80kDa)-HPRD,BioGRID8106553|11157754 
TGFBR3BGCAN | betaglycantransforming growth factor, beta receptor IIITGF-beta-2 interacts with TGF-beta-R-III. This interaction was modeled on a demonstrated interaction between TGF-beta-2 from an unspecified species and rat TGF-beta-R-III.BIND7852346 
-HPRD11157754 
TGFBRAP1TRAP-1 | TRAP1transforming growth factor, beta receptor associated protein 1Affinity Capture-WesternBioGRID11278302 
VASNSLITL2vasorin-HPRD,BioGRID15247411 
VTNV75 | VN | VNTvitronectin-HPRD,BioGRID11796824 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-141/200a1091161A,m8hsa-miR-141UAACACUGUCUGGUAAAGAUGG
hsa-miR-200aUAACACUGUCUGGUAACGAUGU
miR-4951701771A,m8hsa-miR-495brainAAACAAACAUGGUGCACUUCUUU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.