Gene Page: TNFRSF1A

Summary
GeneID  7132
Symbol  TNFRSF1A
Synonyms  CD120a|FPF|MGC19588|TBP1|TNF-R|TNF-R-I|TNF-R55|TNFAR|TNFR1|TNFR55|TNFR60|p55|p55-R|p60
Description  tumor necrosis factor receptor superfamily, member 1A
See related  HGNC:11916|MIM:191190|Ensembl:ENSG00000067182|HPRD:01861|
Locus tag  -
Gene type  protein-coding
Map location  12p13.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenia, schizophrenias]Click to show detail
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.0126 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
PCM10.950.96
PHF30.940.96
SLTM0.940.95
TAF10.940.95
CHD20.930.95
ZNF6380.930.95
RFC10.930.93
CASP8AP20.920.94
SETD20.920.96
ZC3H11A0.920.95
Top 10 negatively co-expressed genes
AF347015.31-0.76-0.85
MT-CO2-0.74-0.83
IFI27-0.74-0.82
AF347015.27-0.73-0.80
FXYD1-0.72-0.80
HIGD1B-0.72-0.83
AF347015.21-0.71-0.85
AF347015.33-0.71-0.78
ENHO-0.71-0.82
MYL3-0.70-0.81
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004872receptor activityIEA-
GO:0005031tumor necrosis factor receptor activityTAS2158863 
GO:0005515protein bindingIPI9115275 |11684708 |15465831 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006693prostaglandin metabolic processISS-
GO:0006915apoptosisIEA-
GO:0019221cytokine-mediated signaling pathwayISS-
GO:0043123positive regulation of I-kappaB kinase/NF-kappaB cascadeIEP12761501 
GO:0045944positive regulation of transcription from RNA polymerase II promoterISS-
GO:0050729positive regulation of inflammatory responseISS-
GO:0044419interspecies interaction between organismsIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005576extracellular regionNAS12189246 
GO:0005886plasma membraneEXP2848815 |7758105 |12887920 
GO:0005886plasma membraneIEA-
GO:0005887integral to plasma membraneTAS1698610 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ARHGDIAGDIA1 | MGC117248 | RHOGDI | RHOGDI-1Rho GDP dissociation inhibitor (GDI) alphaCo-purificationBioGRID15659383 
ATAD3AFLJ10709ATPase family, AAA domain containing 3A-HPRD14743216 
ATP1A1MGC3285 | MGC51750ATPase, Na+/K+ transporting, alpha 1 polypeptide-HPRD14743216 
ATP2A2ATP2B | DAR | DD | DKFZp686P0211 | FLJ20293 | FLJ38063 | MGC45367 | SERCA2ATPase, Ca++ transporting, cardiac muscle, slow twitch 2-HPRD14743216 
ATP5A1ATP5A | ATP5AL2 | ATPM | MOM2 | OMR | ORM | hATP1ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle-HPRD14743216 
BAG4BAG-4 | SODDBCL2-associated athanogene 4-HPRD,BioGRID9915703 
BCL10CARMEN | CIPER | CLAP | c-E10 | mE10B-cell CLL/lymphoma 10Two-hybridBioGRID10400625 
BIDFP497 | MGC15319 | MGC42355BH3 interacting domain death agonistCo-purificationBioGRID15659383 
BIRC2API1 | HIAP2 | Hiap-2 | MIHB | RNF48 | cIAP1baculoviral IAP repeat-containing 2Affinity Capture-WesternBioGRID8943045 
CASP10ALPS2 | FLICE2 | MCH4caspase 10, apoptosis-related cysteine peptidase-HPRD11098060 
Affinity Capture-Western
Co-purification
BioGRID9045686 |15659383 
CASP2CASP-2 | ICH-1L | ICH-1L/1S | ICH1 | NEDD2caspase 2, apoptosis-related cysteine peptidaseAffinity Capture-WesternBioGRID8985253 
CASP7CMH-1 | ICE-LAP3 | MCH3caspase 7, apoptosis-related cysteine peptidase-HPRD,BioGRID11755217 
CASP8ALPS2B | CAP4 | FLICE | FLJ17672 | MACH | MCH5 | MGC78473caspase 8, apoptosis-related cysteine peptidaseCo-purificationBioGRID15659383 
CDIPTMGC1328 | PIS | PIS1CDP-diacylglycerol--inositol 3-phosphatidyltransferase (phosphatidylinositol synthase)-HPRD14743216 
CEP110CEP1 | FAN | bA165P4.1centrosomal protein 110kDaAffinity Capture-WesternBioGRID10187805 
CHUKIKBKA | IKK-alpha | IKK1 | IKKA | NFKBIKA | TCF16conserved helix-loop-helix ubiquitous kinase-HPRD10755617 
CRADDMGC9163 | RAIDDCASP2 and RIPK1 domain containing adaptor with death domainAffinity Capture-WesternBioGRID8985253 
DAPMGC99796death-associated protein-HPRD10187798 
DAPK1DAPK | DKFZp781I035death-associated protein kinase 1-HPRD,BioGRID12911633 
ERAP1A-LAP | ALAP | APPILS | ARTS-1 | ARTS1 | ERAAP | ERAAP1 | KIAA0525 | PILS-AP | PILSAPendoplasmic reticulum aminopeptidase 1ARTS-1 interacts with TNFR1.BIND12189246 
EZRCVIL | CVL | DKFZp762H157 | FLJ26216 | MGC1584 | VIL2ezrinCo-purificationBioGRID15659383 
FADDGIG3 | MGC8528 | MORT1Fas (TNFRSF6)-associated via death domainAffinity Capture-Western
Co-purification
BioGRID8565075 |15659383 
FANCD2DKFZp762A223 | FA-D2 | FA4 | FACD | FAD | FAD2 | FANCD | FLJ23826Fanconi anemia, complementation group D2Affinity Capture-MSBioGRID14743216 
FANCIFLJ10719 | KIAA1794Fanconi anemia, complementation group I-HPRD14743216 
FASALPS1A | APO-1 | APT1 | CD95 | FAS1 | FASTM | TNFRSF6Fas (TNF receptor superfamily, member 6)Co-purificationBioGRID15659383 
FASLGAPT1LG1 | CD178 | CD95L | FASL | TNFSF6Fas ligand (TNF superfamily, member 6)Co-purificationBioGRID15659383 
GCN1L1GCN1 | GCN1L | KIAA0219GCN1 general control of amino-acid synthesis 1-like 1 (yeast)-HPRD14743216 
GNB2L1Gnb2-rs1 | H12.3 | HLC-7 | PIG21 | RACK1guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1TNF-R55 interacts with RACK1.BIND12391233 
-HPRD12391233 
GRB2ASH | EGFRBP-GRB2 | Grb3-3 | MST084 | MSTP084growth factor receptor-bound protein 2-HPRD,BioGRID10359574 
HAX1FLJ17042 | FLJ18492 | FLJ93803 | HCLSBP1 | HS1BP1 | SCN3HCLS1 associated protein X-1-HPRD14743216 
HIST2H4AFO108 | H4 | H4/n | H4F2 | H4FN | HIST2H4histone cluster 2, H4a-HPRD14743216 
HSP90AA1FLJ31884 | HSP86 | HSP89A | HSP90A | HSP90N | HSPC1 | HSPCA | HSPCAL1 | HSPCAL4 | HSPN | Hsp89 | Hsp90 | LAP2heat shock protein 90kDa alpha (cytosolic), class A member 1-HPRD7876093 
HSPA8HSC54 | HSC70 | HSC71 | HSP71 | HSP73 | HSPA10 | LAP1 | MGC131511 | MGC29929 | NIP71heat shock 70kDa protein 8-HPRD,BioGRID11909948 
-HPRD11909948|14743216 
IKBKBFLJ40509 | IKK-beta | IKK2 | IKKB | MGC131801 | NFKBIKBinhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta-HPRD,BioGRID10755617 
IKBKGAMCBX1 | FIP-3 | FIP3 | Fip3p | IKK-gamma | IP | IP1 | IP2 | IPD2 | NEMOinhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma-HPRD,BioGRID10755617 
JAK1JAK1A | JAK1B | JTK3Janus kinase 1 (a protein tyrosine kinase)-HPRD,BioGRID11801527 
JAK2JTK10Janus kinase 2 (a protein tyrosine kinase)-HPRD,BioGRID9510175 
LRRC59FLJ21675 | PRO1855leucine rich repeat containing 59-HPRD14743216 
LTALT | TNFB | TNFSF1lymphotoxin alpha (TNF superfamily, member 1)-HPRD,BioGRID8387891 
LTBTNFC | TNFSF3 | p33lymphotoxin beta (TNF superfamily, member 3)-HPRD,BioGRID7995952 
MADDDENN | FLJ35600 | FLJ36300 | IG20 | KIAA0358 | RAB3GEPMAP-kinase activating death domain-HPRD,BioGRID9115275 
MAPK8JNK | JNK1 | JNK1A2 | JNK21B1/2 | PRKM8 | SAPK1mitogen-activated protein kinase 8Co-purificationBioGRID15659383 
MOAP1MAP-1 | PNMA4modulator of apoptosis 1TNF-R1 interacts with MAP-1.BIND15949439 
MON2KIAA1040 | MGC35493MON2 homolog (S. cerevisiae)-HPRD14743216 
MRCL3MLCB | MRLC3myosin regulatory light chain MRCL3-HPRD14743216 
MSN-moesinCo-purificationBioGRID15659383 
MYL6ESMLC | LC17-GI | LC17-NM | LC17A | LC17B | MLC1SM | MLC3NM | MLC3SMmyosin, light chain 6, alkali, smooth muscle and non-muscle-HPRD14743216 
NOL3ARC | CARD2 | MYC | MYP | NOP | NOP30nucleolar protein 3 (apoptosis repressor with CARD domain)Phenotypic SuppressionBioGRID9560245 
NSMAFFANneutral sphingomyelinase (N-SMase) activation associated factor-HPRD,BioGRID8808629 
TNF-R55 interacts with FAN.BIND12391233 
PIP4K2BPI5P4KB | PIP5K2B | PIP5KIIB | PIP5KIIbetaphosphatidylinositol-5-phosphate 4-kinase, type II, beta-HPRD,BioGRID9038203 |9753329 
PSMD2MGC14274 | P97 | Rpn1 | S2 | TRAP2proteasome (prosome, macropain) 26S subunit, non-ATPase, 2-HPRD,BioGRID7601280 |9126987 
PTPN11BPTP3 | CFC | MGC14433 | NS1 | PTP-1D | PTP2C | SH-PTP2 | SH-PTP3 | SHP2protein tyrosine phosphatase, non-receptor type 11-HPRD11786908 
PTPN6HCP | HCPH | HPTP1C | PTP-1C | SH-PTP1 | SHP-1 | SHP-1L | SHP1protein tyrosine phosphatase, non-receptor type 6-HPRD11786908 
RALBP1RIP1 | RLIP1 | RLIP76ralA binding protein 1TNFR1 interacts with RIP1.BIND15247912 
RASSF1123F2 | NORE2A | RASSF1A | RDA32 | REH3P21Ras association (RalGDS/AF-6) domain family member 1TNF-R1 interacts with RASSF1A.BIND15949439 
RHOAARH12 | ARHA | RHO12 | RHOH12ras homolog gene family, member ACo-purificationBioGRID15659383 
RIPK1FLJ39204 | RIP | RIP1receptor (TNFRSF)-interacting serine-threonine kinase 1-HPRD,BioGRID8612133 
RIPK2CARD3 | CARDIAK | CCK | GIG30 | RICK | RIP2receptor-interacting serine-threonine kinase 2-HPRD,BioGRID9642260 
RIPK3RIP3receptor-interacting serine-threonine kinase 3-HPRD,BioGRID10339433 
RPS3FLJ26283 | FLJ27450 | MGC87870ribosomal protein S3-HPRD14743216 
SEC61A1HSEC61 | SEC61 | SEC61ASec61 alpha 1 subunit (S. cerevisiae)-HPRD14743216 
STAT1DKFZp686B04100 | ISGF-3 | STAT91signal transducer and activator of transcription 1, 91kDa-HPRD,BioGRID10848577 
SUMO1DAP-1 | GMP1 | OFC10 | PIC1 | SENP2 | SMT3 | SMT3C | SMT3H3 | SUMO-1 | UBL1SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae)Reconstituted Complex
Two-hybrid
BioGRID8906799 |10187798 
TNFDIF | TNF-alpha | TNFA | TNFSF2tumor necrosis factor (TNF superfamily, member 2)-HPRD1331108 |2158863 
Affinity Capture-MS
Affinity Capture-Western
BioGRID12887920 |14743216 
TNF-alpha interacts with TNFR1.BIND7852363 
TNFRSF10BCD262 | DR5 | KILLER | KILLER/DR5 | TRAIL-R2 | TRAILR2 | TRICK2 | TRICK2A | TRICK2B | TRICKB | ZTNFR9tumor necrosis factor receptor superfamily, member 10bCo-purificationBioGRID15659383 
TNFRSF1ACD120a | FPF | MGC19588 | TBP1 | TNF-R | TNF-R-I | TNF-R55 | TNFAR | TNFR1 | TNFR55 | TNFR60 | p55 | p55-R | p60tumor necrosis factor receptor superfamily, member 1A-HPRD8077196|10875917 
Affinity Capture-Western
FRET
Two-hybrid
BioGRID8077196 |10875917 
TNFR1 interacts with itself.BIND8077196 
TNFSF12-TNFSF13TWE-PRILTNFSF12-TNFSF13 readthrough transcript-HPRD10706119 
TNFSF13APRIL | CD256 | TALL2 | TRDL-1 | UNQ383/PRO715 | ligandtumor necrosis factor (ligand) superfamily, member 13Reconstituted ComplexBioGRID10706119 
TRADDHs.89862 | MGC11078TNFRSF1A-associated via death domainAffinity Capture-Western
Two-hybrid
BioGRID8565075 |8612133 
|8943045 |9082980 
|9915703 |10187805 
-HPRD8565075 |8612133 
|10911999|8612133 |10911999 
TRADD interacts with TNFR1.BIND11684708 
-HPRD8612133 |10911999 
TNFR1 interacts with TRADD. This interaction was modeled on a demonstrated interaction between TNFR1 from an unspecified species and human TRADD.BIND11226577 
TNFR1 interacts with TRADD.BIND15247912 
TRAF1EBI6 | MGC:10353TNF receptor-associated factor 1-HPRD,BioGRID8565075 
TRAF2MGC:45012 | TRAP | TRAP3TNF receptor-associated factor 2-HPRD,BioGRID8565075 
TRAP1HSP75 | HSP90LTNF receptor-associated protein 1Reconstituted ComplexBioGRID7876093 
TRPC4APC20orf188 | TRRP4AP | TRUSStransient receptor potential cation channel, subfamily C, member 4 associated proteinAffinity Capture-Western
Reconstituted Complex
BioGRID14585990 
TUBA3CTUBA2 | bA408E5.3tubulin, alpha 3c-HPRD14743216 
TUBB2BDKFZp566F223 | FLJ98847 | MGC8685 | TUBB-PARALOG | bA506K6.1tubulin, beta 2B-HPRD14743216 
TUBB6HsT1601 | MGC132410 | MGC4083 | TUBB-5tubulin, beta 6-HPRD14743216 
UBE2IC358B7.1 | P18 | UBC9ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast)-HPRD,BioGRID9563508 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-291171241A,m8hsa-miR-29aSZUAGCACCAUCUGAAAUCGGUU
hsa-miR-29bSZUAGCACCAUUUGAAAUCAGUGUU
hsa-miR-29cSZUAGCACCAUUUGAAAUCGGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.