Gene Page: TP53BP2

Summary
GeneID  7159
Symbol  TP53BP2
Synonyms  53BP2|ASPP2|BBP|PPP1R13A|p53BP2
Description  tumor protein p53 binding protein, 2
See related  HGNC:12000|MIM:602143|Ensembl:ENSG00000143514|HPRD:11803|
Locus tag  -
Gene type  protein-coding
Map location  1q42.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.0505 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005070SH3/SH2 adaptor activityTAS8668206 
GO:0005515protein bindingIPI11684014 |12694406 |14729977 
GO:0017124SH3 domain bindingIEA-
GO:0051059NF-kappaB bindingIPI10498867 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006917induction of apoptosisIDA11684014 
GO:0007165signal transductionTAS9748285 
GO:0006915apoptosisIEA-
GO:0045786negative regulation of cell cycleTAS14729977 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIEA-
GO:0005737cytoplasmTAS15782125 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
APPAAA | ABETA | ABPP | AD1 | APPI | CTFgamma | CVAP | PN2amyloid beta (A4) precursor protein-HPRD11278849 
BCL2Bcl-2B-cell CLL/lymphoma 2-HPRD,BioGRID8668206 
E2F1E2F-1 | RBAP1 | RBBP3 | RBP3E2F transcription factor 1E2F1 interacts with the TP53BP2 (ASPP2) promoter.BIND15706352 
E2F1 (E2F-1) interacts with the TP53BP2 (ASPP2) promoter.BIND15731768 
E2F2E2F-2E2F transcription factor 2E2F2 interacts with the TP53BP2 (ASPP2) promoter.BIND15706352 
E2F3DKFZp686C18211 | E2F-3 | KIAA0075 | MGC104598E2F transcription factor 3E2F3 interacts with the TP53BP2 (ASPP2) promoter.BIND15706352 
E2F4E2F-4E2F transcription factor 4, p107/p130-bindingE2F4 interacts with the TP53BP2 (ASPP2) promoter.BIND15706352 
EEF1A1CCS-3 | CCS3 | EEF-1 | EEF1A | EF-Tu | EF1A | FLJ25721 | GRAF-1EF | HNGC:16303 | LENG7 | MGC102687 | MGC131894 | MGC16224 | PTI1 | eEF1A-1eukaryotic translation elongation factor 1 alpha 1Two-hybridBioGRID16169070 
KIF5AD12S1889 | MY050 | NKHC | SPG10kinesin family member 5ATwo-hybridBioGRID16169070 
MAGI1AIP3 | BAIAP1 | BAP1 | MAGI-1 | TNRC19 | WWP3membrane associated guanylate kinase, WW and PDZ domain containing 1-HPRD9169421 
MRPL20L20mt | MGC4779 | MGC74465 | MRP-L20mitochondrial ribosomal protein L20Two-hybridBioGRID16169070 
NAE1A-116A10.1 | APPBP1 | HPP1 | ula-1NEDD8 activating enzyme E1 subunit 1ASPP2 inhibits APP-BP1-mediated NEDD8 conjugation to cullin-1 and decreases APP-BP1-induced cell proliferation and neuronal apoptosisBIND12694406 
PPP1CCPPP1Gprotein phosphatase 1, catalytic subunit, gamma isoform-HPRD8549741 
PTNHARP | HBGF8 | HBNF | NEGF1pleiotrophinTwo-hybridBioGRID16169070 
RELAMGC131774 | NFKB3 | p65v-rel reticuloendotheliosis viral oncogene homolog A (avian)-HPRD10498867 
TP53FLJ92943 | LFS1 | TRP53 | p53tumor protein p53-HPRD,BioGRID8016121 |8668206 
|8875926 
UNC119HRG4unc-119 homolog (C. elegans)Two-hybridBioGRID16169070 
USP4MGC149848 | MGC149849 | UNP | Unphubiquitin specific peptidase 4 (proto-oncogene)Two-hybridBioGRID16169070 
UTP14AKIAA0266 | NY-CO-16 | SDCCAG16 | dJ537K23.3UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast)Two-hybridBioGRID16169070 
WWP1AIP5 | DKFZp434D2111 | Tiul1 | hSDRP1WW domain containing E3 ubiquitin protein ligase 1-HPRD9169421 
WWP2AIP2 | WWp2-likeWW domain containing E3 ubiquitin protein ligase 2-HPRD9169421 
YAP1YAP | YAP2 | YAP65 | YKIYes-associated protein 1, 65kDa-HPRD,BioGRID11278422 
YES1HsT441 | P61-YES | Yes | c-yesv-yes-1 Yamaguchi sarcoma viral oncogene homolog 1-HPRD11278422 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-2051421491A,m8hsa-miR-205UCCUUCAUUCCACCGGAGUCUG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.