Gene Page: CCT3

Summary
GeneID  7203
Symbol  CCT3
Synonyms  CCT-gamma|CCTG|PIG48|TCP-1-gamma|TRIC5
Description  chaperonin containing TCP1, subunit 3 (gamma)
See related  HGNC:1616|MIM:600114|Ensembl:ENSG00000163468|HPRD:08969|
Locus tag  RP11-443G18.6
Gene type  protein-coding
Map location  1q23
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.0235 
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.00814 
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenic, schizophrenia]Click to show detail
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0000166nucleotide bindingIEA-
GO:0005524ATP bindingIEA-
GO:0051082unfolded protein bindingIEA-
GO:0051082unfolded protein bindingTAS8573069 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006457protein foldingIEA-
GO:0006457protein foldingTAS8001976 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005856cytoskeletonTAS8001976 
GO:0005634nucleusIDA18029348 
GO:0005737cytoplasmIEA-
GO:0005886plasma membraneIDA18029348 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
CCT299D8.1 | CCT-beta | CCTB | MGC142074 | MGC142076 | PRO1633 | TCP-1-betachaperonin containing TCP1, subunit 2 (beta)-HPRD7953530 
CCT4CCT-DELTA | Cctd | MGC126164 | MGC126165 | SRBchaperonin containing TCP1, subunit 4 (delta)-HPRD7953530 
CCT6ACCT-zeta | CCT-zeta-1 | CCT6 | Cctz | HTR3 | MGC126214 | MGC126215 | MoDP-2 | TCP-1-zeta | TCP20 | TCPZ | TTCP20chaperonin containing TCP1, subunit 6A (zeta 1)-HPRD7953530 
CCT7CCT-ETA | Ccth | MGC110985 | Nip7-1 | TCP-1-etachaperonin containing TCP1, subunit 7 (eta)-HPRD7953530 
CTTNBP2C7orf8 | CORTBP2 | FLJ34229 | KIAA1758 | MGC104579 | Orf4cortactin binding protein 2Affinity Capture-MSBioGRID18782753 
EIF2B2EIF-2Bbeta | EIF2Beukaryotic translation initiation factor 2B, subunit 2 beta, 39kDaTwo-hybridBioGRID16169070 
FANCAFA | FA-H | FA1 | FAA | FACA | FAH | FANCH | MGC75158Fanconi anemia, complementation group ATwo-hybridBioGRID14499622 
HSPA8HSC54 | HSC70 | HSC71 | HSP71 | HSP73 | HSPA10 | LAP1 | MGC131511 | MGC29929 | NIP71heat shock 70kDa protein 8-HPRD10635329 
IGBP1ALPHA-4 | IBP1immunoglobulin (CD79A) binding protein 1Affinity Capture-MSBioGRID16085932 
MOBKL32C4D | CGI-95 | MGC12264 | MOB1 | MOB3 | PREI3MOB1, Mps One Binder kinase activator-like 3 (yeast)Affinity Capture-MSBioGRID18782753 
PAFAH1B2-platelet-activating factor acetylhydrolase, isoform Ib, beta subunit 30kDaTwo-hybridBioGRID16169070 
PPP2CAPP2Ac | PP2CA | RP-Cprotein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoformAffinity Capture-MSBioGRID18782753 
PPP2CBPP2CBprotein phosphatase 2 (formerly 2A), catalytic subunit, beta isoformAffinity Capture-MSBioGRID18782753 
PPP2R2CB55-GAMMA | IMYPNO | IMYPNO1 | MGC33570 | PR52 | PR55Gprotein phosphatase 2 (formerly 2A), regulatory subunit B, gamma isoformAffinity Capture-MSBioGRID18782753 
PPP4CPP4 | PPH3 | PPXprotein phosphatase 4 (formerly X), catalytic subunitAffinity Capture-MSBioGRID16085932 |18715871 
RAF1CRAF | NS5 | Raf-1 | c-Rafv-raf-1 murine leukemia viral oncogene homolog 1RAF1 (C-Raf) interacts with CCT3 (hC87).BIND12620389 
C-RAF interacts with CCT3.BIND12620389 
Two-hybridBioGRID12620389 
SSSCA1p27Sjogren syndrome/scleroderma autoantigen 1Two-hybridBioGRID16189514 
STK24MST-3 | MST3 | MST3B | STE20 | STK3serine/threonine kinase 24 (STE20 homolog, yeast)Affinity Capture-MSBioGRID18782753 
STRNMGC125642 | SG2NAstriatin, calmodulin binding proteinAffinity Capture-MSBioGRID18782753 
STRN3SG2NAstriatin, calmodulin binding protein 3Affinity Capture-MSBioGRID18782753 
TCP1CCT-alpha | CCT1 | CCTa | D6S230E | TCP-1-alphat-complex 1Affinity Capture-MSBioGRID16085932 
-HPRD7953530 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-1287379m8hsa-miR-128aUCACAGUGAACCGGUCUCUUUU
hsa-miR-128bUCACAGUGAACCGGUCUCUUUC
miR-14955621A,m8hsa-miR-149brainUCUGGCUCCGUGUCUUCACUCC
miR-2453601A,m8hsa-miR-24SZUGGCUCAGUUCAGCAGGAACAG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.