Gene Page: VAV1

Summary
GeneID  7409
Symbol  VAV1
Synonyms  VAV
Description  vav 1 guanine nucleotide exchange factor
See related  HGNC:12657|MIM:164875|Ensembl:ENSG00000141968|HPRD:01284|
Locus tag  -
Gene type  protein-coding
Map location  19p13.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.1991 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005085guanyl-nucleotide exchange factor activityIEA-
GO:0003700transcription factor activityTAS2477241 
GO:0005515protein bindingIPI10394361 
GO:0008270zinc ion bindingIEA-
GO:0019992diacylglycerol bindingIEA-
GO:0030676Rac guanyl-nucleotide exchange factor activityIEA-
GO:0046872metal ion bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007242intracellular signaling cascadeIEA-
GO:0007229integrin-mediated signaling pathwayIEA-
GO:0006955immune responseIEA-
GO:0006909phagocytosisIEA-
GO:0035023regulation of Rho protein signal transductionIEA-
GO:0043087regulation of GTPase activityIEA-
GO:0045785positive regulation of cell adhesionIEA-
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005622intracellularIEA-
GO:0005737cytoplasmIDA18029348 
GO:0043231intracellular membrane-bounded organelleIDA18029348 
 
Protein-protein InteractionsShown by network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ABL1ABL | JTK7 | bcr/abl | c-ABL | p150 | v-ablc-abl oncogene 1, receptor tyrosine kinaseAffinity Capture-Western
Biochemical Activity
Reconstituted Complex
Two-hybrid
BioGRID11790798 
AOC3HPAO | SSAO | VAP-1 | VAP1amine oxidase, copper containing 3 (vascular adhesion protein 1)-HPRD1375396 
ARHGDIBD4 | GDIA2 | GDID4 | LYGDI | Ly-GDI | RAP1GN1 | RhoGDI2Rho GDP dissociation inhibitor (GDI) beta-HPRD,BioGRID10664460 
BCRALL | BCR-ABL1 | BCR1 | CML | D22S11 | D22S662 | FLJ16453 | PHLbreakpoint cluster region-HPRD11790798 
BLNKBASH | BLNK-S | LY57 | MGC111051 | SLP-65 | SLP65B-cell linker-HPRD,BioGRID9697839 
BTKAGMX1 | AT | ATK | BPK | IMD1 | MGC126261 | MGC126262 | PSCTK1 | XLABruton agammaglobulinemia tyrosine kinase-HPRD,BioGRID9201297 
CBLC-CBL | CBL2 | RNF55Cas-Br-M (murine) ecotropic retroviral transforming sequence-HPRD9200440 |11133830 
Affinity Capture-Western
Far Western
Reconstituted Complex
BioGRID9200440 |11331248 
CBLBDKFZp686J10223 | DKFZp779A0729 | DKFZp779F1443 | FLJ36865 | FLJ41152 | Nbla00127 | RNF56Cas-Br-M (murine) ecotropic retroviral transforming sequence b-HPRD,BioGRID11857085 
CD19B4 | MGC12802CD19 molecule-HPRD,BioGRID7528218 
CDC42CDC42Hs | G25Kcell division cycle 42 (GTP binding protein, 25kDa)-HPRD,BioGRID11287617 
CRKCRKIIv-crk sarcoma virus CT10 oncogene homolog (avian)-HPRD8621483 
DNM2CMTDI1 | CMTDIB | DI-CMTB | DYN2 | DYNIIdynamin 2An unspecified isoform of Dyn2 interacts with Vav1.BIND15696170 
DOCK2FLJ46592 | KIAA0209dedicator of cytokinesis 2-HPRD,BioGRID12393632 
EGFRERBB | ERBB1 | HER1 | PIG61 | mENAepidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)-HPRD,BioGRID10938113 
EMDEDMD | LEMD5 | STAemerinTwo-hybridBioGRID12755701 
EPORMGC138358erythropoietin receptor-HPRD,BioGRID9162069 
EZH2ENX-1 | EZH1 | KMT6 | MGC9169enhancer of zeste homolog 2 (Drosophila)-HPRD,BioGRID8649418 |10780782 
FCER1AFCE1A | FcERIFc fragment of IgE, high affinity I, receptor for; alpha polypeptideAffinity Capture-WesternBioGRID8900182 
FYNMGC45350 | SLK | SYNFYN oncogene related to SRC, FGR, YES-HPRD,BioGRID9822663 
GRB2ASH | EGFRBP-GRB2 | Grb3-3 | MST084 | MSTP084growth factor receptor-bound protein 2-HPRD,BioGRID7809090 
Grb2 interacts with VavBIND9013873 
HNRNPKCSBP | FLJ41122 | HNRPK | TUNPheterogeneous nuclear ribonucleoprotein K-HPRD,BioGRID8051112 
HRASC-BAS/HAS | C-H-RAS | C-HA-RAS1 | CTLO | H-RASIDX | HAMSV | HRAS1 | K-RAS | N-RAS | RASH1v-Ha-ras Harvey rat sarcoma viral oncogene homolog-HPRD8554611 
IL6STCD130 | CDw130 | GP130 | GP130-RAPS | IL6R-betainterleukin 6 signal transducer (gp130, oncostatin M receptor)-HPRD,BioGRID9013873 
Vav interacts with gp130.BIND9013873 
INSRCD220 | HHF5insulin receptor-HPRD,BioGRID7535775 
JAK2JTK10Janus kinase 2 (a protein tyrosine kinase)-HPRD,BioGRID7530656 |9162069 
JUNAP-1 | AP1 | c-Junjun oncogeneBiochemical ActivityBioGRID11287617 
LATLAT1 | pp36linker for activation of T cells-HPRD,BioGRID11368773 
LCP2SLP-76 | SLP76lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)-HPRD,BioGRID9047237 |9341187 
|11331248 
MAP2K1MAPKK1 | MEK1 | MKK1 | PRKMK1mitogen-activated protein kinase kinase 1Affinity Capture-WesternBioGRID8900182 
MAPK1ERK | ERK2 | ERT1 | MAPK2 | P42MAPK | PRKM1 | PRKM2 | p38 | p40 | p41 | p41mapkmitogen-activated protein kinase 1-HPRD,BioGRID8900182 |9013873 
Vav interacts with ERK2.BIND9013873 
PAG1CBP | FLJ37858 | MGC138364 | PAGphosphoprotein associated with glycosphingolipid microdomains 1-HPRD,BioGRID10790433 
PDGFRBCD140B | JTK12 | PDGF-R-beta | PDGFR | PDGFR1platelet-derived growth factor receptor, beta polypeptideAffinity Capture-WesternBioGRID10938113 
PIK3R1GRB1 | p85 | p85-ALPHAphosphoinositide-3-kinase, regulatory subunit 1 (alpha)-HPRD7528218 |9891995 
Affinity Capture-Western
Reconstituted Complex
BioGRID9162069 |9891995 
PLCG1PLC-II | PLC1 | PLC148 | PLCgamma1phospholipase C, gamma 1-HPRD,BioGRID9891995 
PLCG2-phospholipase C, gamma 2 (phosphatidylinositol-specific)Affinity Capture-WesternBioGRID10981967 
PRKCQMGC126514 | MGC141919 | PRKCT | nPKC-thetaprotein kinase C, thetaPRKCQ (PKC-theta) interacts with VAV1. This interaction was modelled on a demonstrated interaction between human PRKCQ and VAV1 from an unspecified species.BIND14673152 
-HPRD,BioGRID10725744 
PRLRhPRLrIprolactin receptor-HPRD,BioGRID7768923 
PTK2BCADTK | CAKB | FADK2 | FAK2 | FRNK | PKB | PTK | PYK2 | RAFTKPTK2B protein tyrosine kinase 2 beta-HPRD,BioGRID10867021 
PTPN6HCP | HCPH | HPTP1C | PTP-1C | SH-PTP1 | SHP-1 | SHP-1L | SHP1protein tyrosine phosphatase, non-receptor type 6-HPRD,BioGRID8632004 
PTPRCB220 | CD45 | CD45R | GP180 | LCA | LY5 | T200protein tyrosine phosphatase, receptor type, C-HPRD8570203 
RAC1MGC111543 | MIG5 | TC-25 | p21-Rac1ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)Affinity Capture-WesternBioGRID11287617 
RACGAP1HsCYK-4 | ID-GAP | MgcRacGAPRac GTPase activating protein 1-HPRD,BioGRID10748082 
RAF1CRAF | NS5 | Raf-1 | c-Rafv-raf-1 murine leukemia viral oncogene homolog 1-HPRD,BioGRID8900182 
S100BNEF | S100 | S100betaS100 calcium binding protein BAffinity Capture-Western
Reconstituted Complex
BioGRID10394361 
SH3BP23BP2 | CRBM | CRPM | FLJ42079 | RES4-23SH3-domain binding protein 2-HPRD,BioGRID11390470 
SHBRP11-3J10.8 | bA3J10.2Src homology 2 domain containing adaptor protein B-HPRD,BioGRID12084069 
SIAH1FLJ08065 | HUMSIAH | Siah-1 | Siah-1a | hSIAH1seven in absentia homolog 1 (Drosophila)Two-hybridBioGRID10207103 
SIAH2hSiah2seven in absentia homolog 2 (Drosophila)-HPRD,BioGRID10207103 
SLASLA1 | SLAPSrc-like-adaptor-HPRD,BioGRID10662792 
SOCS1CIS1 | CISH1 | JAB | SOCS-1 | SSI-1 | SSI1 | TIP3suppressor of cytokine signaling 1-HPRD,BioGRID10022833 
Socs1 interacts with Vav. This interaction was modeled on a demonstrated interaction between mouse Socs1 and Vav.BIND10022833 
SYKDKFZp313N1010 | FLJ25043 | FLJ37489spleen tyrosine kinase-HPRD,BioGRID8986718 
TECMGC126760 | MGC126762 | PSCTK4tec protein tyrosine kinaseAffinity Capture-WesternBioGRID11328862 
-HPRD7651724 
TYK2JTK1tyrosine kinase 2-HPRD,BioGRID10673353 
XRCC5FLJ39089 | KARP-1 | KARP1 | KU80 | KUB2 | Ku86 | NFIVX-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining)Affinity Capture-WesternBioGRID10673353 
XRCC6CTC75 | CTCBF | G22P1 | KU70 | ML8 | TLAAX-ray repair complementing defective repair in Chinese hamster cells 6-HPRD,BioGRID8524317 
ZAP70FLJ17670 | FLJ17679 | SRK | STD | TZK | ZAP-70zeta-chain (TCR) associated protein kinase 70kDa-HPRD,BioGRID7798261 
ZYXESP-2 | HED-2zyxin-HPRD8622875 
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-244046m8hsa-miR-24SZUGGCUCAGUUCAGCAGGAACAG
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.