Gene Page: PHF23

Summary
GeneID  79142
Symbol  PHF23
Synonyms  FLJ16355|FLJ22884|MGC2941|hJUNE-1b
Description  PHD finger protein 23
See related  HGNC:28428|Ensembl:ENSG00000040633|
Locus tag  -
Gene type  protein-coding
Map location  17p13.1
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
ExpressionExpressionP value: 1.777 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0005515protein bindingIEA-
GO:0008270zinc ion bindingIEA-
GO:0046872metal ion bindingIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
PRSS23MGC5107 | SIG13 | SPUVE | ZSIG13protease, serine, 23Two-hybridBioGRID16169070 
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-245056m8hsa-miR-24SZUGGCUCAGUUCAGCAGGAACAG
miR-261851911Ahsa-miR-26abrainUUCAAGUAAUCCAGGAUAGGC
hsa-miR-26bSZUUCAAGUAAUUCAGGAUAGGUU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.