Gene Page: THTPA

Summary
GeneID  79178
Symbol  THTPA
Synonyms  MGC2652|THTP|THTPASE
Description  thiamine triphosphatase
See related  HGNC:18987|MIM:611612|Ensembl:ENSG00000157306|HPRD:15505|
Locus tag  -
Gene type  protein-coding
Map location  14q11.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.047 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004016adenylate cyclase activityIEA-
GO:0050333thiamin-triphosphatase activityIDA11827967 
GO:0016787hydrolase activityTAS11827967 
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0006171cAMP biosynthetic processIEA-
GO:0006091generation of precursor metabolites and energyNAS11827967 
GO:0006772thiamin metabolic processTAS11827967 
GO:0016311dephosphorylationIDA11827967 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005625soluble fractionNAS11827967 
GO:0005737cytoplasmIEA-
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-218292298m8hsa-miR-218brainUUGUGCUUGAUCUAACCAUGU
miR-313083141Ahsa-miR-31AGGCAAGAUGCUGGCAUAGCUG
miR-485-5p232238m8hsa-miR-485-5pAGAGGCUGGCCGUGAUGAAUUC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.