Gene Page: EHMT1

Summary
GeneID  79813
Symbol  EHMT1
Synonyms  DKFZp667M072|EUHMTASE1|Eu-HMTase1|FLJ12879|FP13812|GLP|KIAA1876|KMT1D|bA188C12.1
Description  euchromatic histone-lysine N-methyltransferase 1
See related  HGNC:24650|MIM:607001|Ensembl:ENSG00000181090|HPRD:07383|
Locus tag  RP11-188C12.1
Gene type  protein-coding
Map location  9q34.3
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
ExpressionExpressionP value: 1.836 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0016740transferase activityIEA-
GO:0008270zinc ion bindingIEA-
GO:0008168methyltransferase activityIDA12004135 
GO:0018024histone-lysine N-methyltransferase activityIDA12004135 
GO:0046872metal ion bindingIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0016568chromatin modificationIDA12004135 
GO:0016571histone methylationIDA12004135 
Cellular componentGO termEvidenceNeuro keywordsPubMed ID
GO:0005634nucleusIC12004135 
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-18679685m8hsa-miR-18aUAAGGUGCAUCUAGUGCAGAUA
hsa-miR-18bUAAGGUGCAUCUAGUGCAGUUA
miR-21710521058m8hsa-miR-217UACUGCAUCAGGAACUGAUUGGAU
miR-3758518571Ahsa-miR-375UUUGUUCGUUCGGCUCGCGUGA
miR-409-3p104210491A,m8hsa-miR-409-3pCGAAUGUUGCUCGGUGAACCCCU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.