Gene Page: C13orf18

Summary
GeneID  80183
Symbol  C13orf18
Synonyms  FLJ21562|FLJ43762
Description  chromosome 13 open reading frame 18
See related  HGNC:20420|Ensembl:ENSG00000102445|HPRD:12615|
Locus tag  -
Gene type  protein-coding
Map location  13q14.12
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
LiteratureHigh-throughput literature-searchCo-occurance with Schizophrenia keywords: [schizophrenias, schizophrenia]Click to show detail
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Molecular functionGO termEvidenceNeuro keywordsPubMed ID
GO:0004864protein phosphatase inhibitor activityIEA-
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0009966regulation of signal transductionIEA-
GO:0043666regulation of phosphoprotein phosphatase activityIEA-
 
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-2232562631A,m8hsa-miR-223UGUCAGUUUGUCAAAUACCCC
miR-30-5p1291361A,m8hsa-miR-30a-5pUGUAAACAUCCUCGACUGGAAG
hsa-miR-30cbrainUGUAAACAUCCUACACUCUCAGC
hsa-miR-30dSZUGUAAACAUCCCCGACUGGAAG
hsa-miR-30bSZUGUAAACAUCCUACACUCAGCU
hsa-miR-30e-5pUGUAAACAUCCUUGACUGGA
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.