Gene Page: KIAA1712

Summary
GeneID  80817
Symbol  KIAA1712
Synonyms  PS1TP3
Description  KIAA1712
See related  HGNC:29356|Ensembl:ENSG00000164118|HPRD:13885|
Locus tag  -
Gene type  protein-coding
Map location  4q34
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
ExpressionExpressionP value: 1.462 
NetworkShortest path distance of core genes in the Human protein-protein interaction networkContribution to shortest path in PPI network: 0.024 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
ABI3NESH | SSH3BP3ABI family, member 3Two-hybridBioGRID16189514 
MAPK9JNK-55 | JNK2 | JNK2A | JNK2ALPHA | JNK2B | JNK2BETA | PRKM9 | SAPK | p54a | p54aSAPKmitogen-activated protein kinase 9Two-hybridBioGRID16189514 
MCRS1ICP22BP | INO80Q | MCRS2 | MSP58 | P78microspherule protein 1Two-hybridBioGRID16189514 
RNF8FLJ12013 | KIAA0646ring finger protein 8Two-hybridBioGRID16189514 
SPERTCBY2 | FLJ35810 | NURITspermatid associatedTwo-hybridBioGRID16189514 
ZNF250FLJ57354 | MGC111123 | MGC9718 | ZFP647 | ZNF647zinc finger protein 250Two-hybridBioGRID16189514 
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-505282288m8hsa-miR-505GUCAACACUUGCUGGUUUCCUC
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.