Gene Page: STMN4

Summary
GeneID  81551
Symbol  STMN4
Synonyms  MGC111012|RB3
Description  stathmin-like 4
See related  HGNC:16078|Ensembl:ENSG00000015592|HPRD:18120|
Locus tag  -
Gene type  protein-coding
Map location  8p21.2
 
Gene in Data Sources
Gene set name Method of gene set Evidence Info
GSMA_Igenome scan meta-analysisPsr: 0.031 
GSMA_IIEgenome scan meta-analysis (European-ancestry samples)Psr: 0.00057 
GSMA_IIAgenome scan meta-analysis (All samples)Psr: 0.03086 
 
General Gene Expression (microarray) ?
 
Gene Expression in Brain Regions (new)
 
Top co-expressed genes in Brain Regions (new)
GenePearson's Correlation Spearman's Correlation
Top 10 positively co-expressed genes
Top 10 negatively co-expressed genes
Gene Ontology
Biological processGO termEvidenceNeuro keywordsPubMed ID
GO:0007242intracellular signaling cascadeIEA-
 
InteractionsShown by Network
InteractorsAliases BOfficial full name BExperimentalSourcePubMed ID
IMMTDKFZp779P1653 | HMP | MGC111146 | P87 | P87/89 | P89 | PIG4 | PIG52inner membrane protein, mitochondrial (mitofilin)Two-hybridBioGRID16169070 
PHIPFLJ20705 | FLJ45918 | MGC90216 | WDR11 | ndrppleckstrin homology domain interacting proteinTwo-hybridBioGRID16169070 
TRPC5TRP5transient receptor potential cation channel, subfamily C, member 5Affinity Capture-WesternBioGRID12858178 
 
Pathway annotation
miRNA Targets ?
miRNA familyTarget positionmiRNA IDmiRNA seq
UTR startUTR endMatch method
miR-135173179m8hsa-miR-135aUAUGGCUUUUUAUUCCUAUGUGA
hsa-miR-135bUAUGGCUUUUCAUUCCUAUGUG
miR-1502102161Ahsa-miR-150UCUCCCAACCCUUGUACCAGUG
miR-433-3p522528m8hsa-miR-433brainAUCAUGAUGGGCUCCUCGGUGU
  • SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
  • Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.


Copyright © Bioinformatics and Systems Medicine Laboratory All Rights Reserved since 2009.